EMAIL THIS PAGE TO A FRIEND

ZIC1

Zic family member 1

Synonyms: ZIC ZNF201
UniProtKB ID: Q15915, Q2M3N1
Gene ID:
Human(7545) Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
Mouse(22771) zinc finger protein of the cerebellum 1
Rat(64618) Zic family member 1
Zebrafish(30096) zic family member 1 (odd-paired homolog, Drosophila)
domestic cat(101083197) Zic family member 1
chicken(374103) Zic family member 1
cow(516827) Zic family member 1
sheep(101104550) Zic family member 1
naked mole-rat(101711693) Zic family member 1
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411978 ANTI-ZIC1 antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411979 ANTI-ZIC1 antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411980 ANTI-ZIC1 antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412478 ANTI-ZIC1 antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412576 ANTI-ZIC1 antibody produced in mouse clone 4D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412577 ANTI-ZIC1 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412578 ANTI-ZIC1 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412579 ANTI-ZIC1 antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA004098 Anti-ZIC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503112 Anti-ZIC1 antibody produced in rabbit affinity isolated antibody human, mouse
pricing
SAB4503113 Anti-ZIC1 antibody produced in rabbit affinity isolated antibody mouse, human
pricing
Z4525 Anti-ZIC2 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
WH0007545M1 Monoclonal Anti-ZIC1 antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404537 Monoclonal Anti-ZIC1 antibody produced in mouse clone 2D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112051 MISSION® esiRNA esiRNA human ZIC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003412 Rosetta Predictions human pricing
NM_022677 Rosetta Predictions rat pricing
NM_009573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062105 predicted 1009
2 SASI_Hs01_00062106 predicted 2015
3 SASI_Hs01_00062107 predicted 1660
4 SASI_Hs01_00062108 predicted 1837
5 SASI_Hs01_00062109 predicted 1744
6 SASI_Hs01_00062110 predicted 1934
7 SASI_Hs01_00062111 predicted 1181
8 SASI_Hs01_00062112 predicted 1835
9 SASI_Hs01_00062113 predicted 1373
10 SASI_Hs01_00062114 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090254 predicted 663
2 SASI_Rn01_00090255 predicted 579
3 SASI_Rn01_00090259 predicted 328
4 SASI_Rn01_00090261 predicted 292
5 SASI_Rn01_00090262 predicted 257
6 SASI_Rn01_00090263 predicted 907
7 SASI_Rn02_00263459 predicted 939
8 SASI_Rn01_00090256 predicted 634
9 SASI_Rn02_00263460 predicted 786
10 SASI_Rn02_00263461 predicted 1216
11 SASI_Rn01_00090257 predicted 661
12 SASI_Rn01_00090258 predicted 851
13 SASI_Rn01_00090260 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166511 predicted 1451
2 SASI_Mm01_00166512 predicted 1368
3 SASI_Mm01_00166513 predicted 1110
4 SASI_Mm01_00166514 predicted 1070
5 SASI_Mm01_00166515 predicted 1041
6 SASI_Mm01_00166516 predicted 1936
7 SASI_Mm01_00166517 predicted 1689
8 SASI_Mm01_00166518 predicted 1687
9 SASI_Mm01_00166519 predicted 1896
10 SASI_Mm01_00166520 predicted 1995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003412
ZIC1 MISSION shRNA Bacterial Glycerol Stock
Zic family member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2102s21c1
Sequence:CCGGGACTGATCACACACGTATACACTCGAGTGTATACGTGTGTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2355s21c1
Sequence:CCGGGGCCAGTTTCTTGTCGAATTGCTCGAGCAATTCGACAAGAAACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2198s21c1
Sequence:CCGGCAATAGACCCAGGACGAGTAACTCGAGTTACTCGTCCTGGGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003412.3-1841s21c1
Sequence:CCGGCAGTTCGCTGCGCAAACACATCTCGAGATGTGTTTGCGCAGCGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003412.3-4193s1c1
Sequence:CCGGGCCATATTTGACTCTGAGAAACTCGAGTTTCTCAGAGTCAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1514s1c1
Sequence:CCGGGCAGAGTAATCACATCTGCTTCTCGAGAAGCAGATGTGATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1789s1c1
Sequence:CCGGCGAGCGACAAGCCCTATCTTTCTCGAGAAAGATAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1661s1c1
Sequence:CCGGGCGCTCCGAGAATTTAAAGATCTCGAGATCTTTAAATTCTCGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003412
ZIC1 MISSION shRNA shRNA Plasmid DNA
Zic family member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2102s21c1
Sequence:CCGGGACTGATCACACACGTATACACTCGAGTGTATACGTGTGTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2355s21c1
Sequence:CCGGGGCCAGTTTCTTGTCGAATTGCTCGAGCAATTCGACAAGAAACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2198s21c1
Sequence:CCGGCAATAGACCCAGGACGAGTAACTCGAGTTACTCGTCCTGGGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003412.3-1841s21c1
Sequence:CCGGCAGTTCGCTGCGCAAACACATCTCGAGATGTGTTTGCGCAGCGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003412.3-4193s1c1
Sequence:CCGGGCCATATTTGACTCTGAGAAACTCGAGTTTCTCAGAGTCAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1514s1c1
Sequence:CCGGGCAGAGTAATCACATCTGCTTCTCGAGAAGCAGATGTGATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1789s1c1
Sequence:CCGGCGAGCGACAAGCCCTATCTTTCTCGAGAAAGATAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1661s1c1
Sequence:CCGGGCGCTCCGAGAATTTAAAGATCTCGAGATCTTTAAATTCTCGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003412
ZIC1 MISSION shRNA Lentiviral Transduction Particles
Zic family member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2102s21c1
Sequence:CCGGGACTGATCACACACGTATACACTCGAGTGTATACGTGTGTGATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2355s21c1
Sequence:CCGGGGCCAGTTTCTTGTCGAATTGCTCGAGCAATTCGACAAGAAACTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003412.3-2198s21c1
Sequence:CCGGCAATAGACCCAGGACGAGTAACTCGAGTTACTCGTCCTGGGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003412.3-1841s21c1
Sequence:CCGGCAGTTCGCTGCGCAAACACATCTCGAGATGTGTTTGCGCAGCGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003412.3-4193s1c1
Sequence:CCGGGCCATATTTGACTCTGAGAAACTCGAGTTTCTCAGAGTCAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1514s1c1
Sequence:CCGGGCAGAGTAATCACATCTGCTTCTCGAGAAGCAGATGTGATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1789s1c1
Sequence:CCGGCGAGCGACAAGCCCTATCTTTCTCGAGAAAGATAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003412.3-1661s1c1
Sequence:CCGGGCGCTCCGAGAATTTAAAGATCTCGAGATCTTTAAATTCTCGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009573
ZIC1 MISSION shRNA Bacterial Glycerol Stock
Zic family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009573.3-3052s1c1
Sequence:CCGGCGCATGTAAAGGGTCTGGTTTCTCGAGAAACCAGACCCTTTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1451s1c1
Sequence:CCGGAGAGCTTATCTGTAAATGGATCTCGAGATCCATTTACAGATAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1852s1c1
Sequence:CCGGCGAGCGACAAGCCCTACCTTTCTCGAGAAAGGTAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1051s1c1
Sequence:CCGGCCAGCGCTGCTTTCAATTCTACTCGAGTAGAATTGAAAGCAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-813s1c1
Sequence:CCGGGCGATTGGTGTGACCACCTTTCTCGAGAAAGGTGGTCACACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009573
ZIC1 MISSION shRNA shRNA Plasmid DNA
Zic family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009573.3-3052s1c1
Sequence:CCGGCGCATGTAAAGGGTCTGGTTTCTCGAGAAACCAGACCCTTTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1451s1c1
Sequence:CCGGAGAGCTTATCTGTAAATGGATCTCGAGATCCATTTACAGATAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1852s1c1
Sequence:CCGGCGAGCGACAAGCCCTACCTTTCTCGAGAAAGGTAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1051s1c1
Sequence:CCGGCCAGCGCTGCTTTCAATTCTACTCGAGTAGAATTGAAAGCAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-813s1c1
Sequence:CCGGGCGATTGGTGTGACCACCTTTCTCGAGAAAGGTGGTCACACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009573
ZIC1 MISSION shRNA Lentiviral Transduction Particles
Zic family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009573.3-3052s1c1
Sequence:CCGGCGCATGTAAAGGGTCTGGTTTCTCGAGAAACCAGACCCTTTACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1451s1c1
Sequence:CCGGAGAGCTTATCTGTAAATGGATCTCGAGATCCATTTACAGATAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1852s1c1
Sequence:CCGGCGAGCGACAAGCCCTACCTTTCTCGAGAAAGGTAGGGCTTGTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-1051s1c1
Sequence:CCGGCCAGCGCTGCTTTCAATTCTACTCGAGTAGAATTGAAAGCAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009573.3-813s1c1
Sequence:CCGGGCGATTGGTGTGACCACCTTTCTCGAGAAAGGTGGTCACACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks