EMAIL THIS PAGE TO A FRIEND

ZIC2

Zic family member 2

Synonyms: HPE5
UniProtKB ID: O95409, Q5VYA9, Q9H309
Gene ID:
Human(7546) Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
Mouse(22772) zinc finger protein of the cerebellum 2
Rat(361096) Zic family member 2
domestic guinea pig(100723859) Zic family member 2
cow(514433) Zic family member 2
sheep(101112492) Zic family member 2
chicken(428021) Zic family member 2
Horse(100062051) Zic family member 2
domestic cat(101084160) Zic family member 2
dog(485533) Zic family member 2
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007129 Rosetta Predictions human pricing
NM_001108392 Rosetta Predictions rat pricing
NM_009574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343016 predicted 798
2 SASI_Hs01_00091546 predicted 1931
3 SASI_Hs01_00091547 predicted 1871
4 SASI_Hs02_00343017 predicted 804
5 SASI_Hs01_00091548 predicted 1670
6 SASI_Hs01_00091550 predicted 126
7 SASI_Hs01_00091551 predicted 1994
8 SASI_Hs01_00091552 predicted 1926
9 SASI_Hs01_00091553 predicted 1674
10 SASI_Hs01_00091554 predicted 1657
11 SASI_Hs01_00091545 predicted 1129
12 SASI_Hs01_00091549 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238209 predicted 198
2 SASI_Rn02_00238210 predicted 989
3 SASI_Rn02_00238211 predicted 980
4 SASI_Rn02_00238212 predicted 927
5 SASI_Rn02_00238213 predicted 986
6 SASI_Rn02_00238214 predicted 925
7 SASI_Rn02_00238215 predicted 975
8 SASI_Rn02_00238216 predicted 224
9 SASI_Rn02_00238217 predicted 929
10 SASI_Rn02_00238218 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186265 predicted 421
2 SASI_Mm01_00186270 predicted 1217
3 SASI_Mm01_00186272 predicted 1225
4 SASI_Mm01_00186273 predicted 518
5 SASI_Mm01_00186274 predicted 1212
6 SASI_Mm02_00316463 predicted 2252
7 SASI_Mm02_00316464 predicted 1940
8 SASI_Mm01_00186267 predicted 1425
9 SASI_Mm01_00186268 predicted 1226
10 SASI_Mm02_00316465 predicted 2266
11 SASI_Mm01_00186266 predicted 440
12 SASI_Mm01_00186269 predicted 1371
13 SASI_Mm01_00186271 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009574
ZIC2 MISSION shRNA Bacterial Glycerol Stock
Zic family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009574.2-2238s1c1
Sequence:CCGGCCATTTGTAAACTCCCGGATTCTCGAGAATCCGGGAGTTTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1034s1c1
Sequence:CCGGGCAGCTAAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-547s1c1
Sequence:CCGGCCGCACACGTTGGCTCCTATTCTCGAGAATAGGAGCCAACGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1405s1c1
Sequence:CCGGCCTCAGATAAGCCCTATCTCTCTCGAGAGAGATAGGGCTTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1808s1c1
Sequence:CCGGCTCCAACTTCAATGAATGGTACTCGAGTACCATTCATTGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009574
ZIC2 MISSION shRNA shRNA Plasmid DNA
Zic family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009574.2-2238s1c1
Sequence:CCGGCCATTTGTAAACTCCCGGATTCTCGAGAATCCGGGAGTTTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1034s1c1
Sequence:CCGGGCAGCTAAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-547s1c1
Sequence:CCGGCCGCACACGTTGGCTCCTATTCTCGAGAATAGGAGCCAACGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1405s1c1
Sequence:CCGGCCTCAGATAAGCCCTATCTCTCTCGAGAGAGATAGGGCTTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1808s1c1
Sequence:CCGGCTCCAACTTCAATGAATGGTACTCGAGTACCATTCATTGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009574
ZIC2 MISSION shRNA Lentiviral Transduction Particles
Zic family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009574.2-2238s1c1
Sequence:CCGGCCATTTGTAAACTCCCGGATTCTCGAGAATCCGGGAGTTTACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1034s1c1
Sequence:CCGGGCAGCTAAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-547s1c1
Sequence:CCGGCCGCACACGTTGGCTCCTATTCTCGAGAATAGGAGCCAACGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1405s1c1
Sequence:CCGGCCTCAGATAAGCCCTATCTCTCTCGAGAGAGATAGGGCTTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009574.2-1808s1c1
Sequence:CCGGCTCCAACTTCAATGAATGGTACTCGAGTACCATTCATTGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007129
ZIC2 MISSION shRNA Bacterial Glycerol Stock
Zic family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-97s1c1
Sequence:CCGGGCCGAGATGCAGGACCGTGAACTCGAGTTCACGGTCCTGCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-1225s1c1
Sequence:CCGGCGGAAGCACATGAAGGTCCATCTCGAGATGGACCTTCATGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-648s1c1
Sequence:CCGGCATGAATATGAACATGGGTATCTCGAGATACCCATGTTCATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-792s1c1
Sequence:CCGGGCAACTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007129.2-1807s1c1
Sequence:CCGGCCGGAGTCTTTGAAGCTGAAACTCGAGTTTCAGCTTCAAAGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007129
ZIC2 MISSION shRNA shRNA Plasmid DNA
Zic family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-97s1c1
Sequence:CCGGGCCGAGATGCAGGACCGTGAACTCGAGTTCACGGTCCTGCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-1225s1c1
Sequence:CCGGCGGAAGCACATGAAGGTCCATCTCGAGATGGACCTTCATGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-648s1c1
Sequence:CCGGCATGAATATGAACATGGGTATCTCGAGATACCCATGTTCATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-792s1c1
Sequence:CCGGGCAACTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007129.2-1807s1c1
Sequence:CCGGCCGGAGTCTTTGAAGCTGAAACTCGAGTTTCAGCTTCAAAGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007129
ZIC2 MISSION shRNA Lentiviral Transduction Particles
Zic family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-97s1c1
Sequence:CCGGGCCGAGATGCAGGACCGTGAACTCGAGTTCACGGTCCTGCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-1225s1c1
Sequence:CCGGCGGAAGCACATGAAGGTCCATCTCGAGATGGACCTTCATGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-648s1c1
Sequence:CCGGCATGAATATGAACATGGGTATCTCGAGATACCCATGTTCATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007129.2-792s1c1
Sequence:CCGGGCAACTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007129.2-1807s1c1
Sequence:CCGGCCGGAGTCTTTGAAGCTGAAACTCGAGTTTCAGCTTCAAAGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks