EMAIL THIS PAGE TO A FRIEND

ZIC3

Zic family member 3

Synonyms: HTX HTX1 VACTERLX ZNF203
UniProtKB ID: O60481, B2CNW4, Q14DE5, Q5JY75
Gene ID:
Human(7547) Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This nuclear protein probably functions as a transcription factor in early stages of left-right body axis formation. Mutations in this gene cause X-linked visceral heterotaxy, which includes congenital heart disease and left-right axis defects in organs. [provided by RefSeq, Jul 2008]
Mouse(22773) zinc finger protein of the cerebellum 3
Rat(367944) Zic family member 3
Zebrafish(368263) zic family member 3 heterotaxy 1 (odd-paired homolog, Drosophila)
chicken(422251) Zic family member 3
Horse(100054537) Zic family member 3
dog(492171) Zic family member 3
cow(541035) Zic family member 3
sheep(101116459) Zic family member 3
domestic guinea pig(100717622) Zic family member 3
naked mole-rat(101697574) Zic family member 3
Domestic Rabbit(100347605) Zic family member 3
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412521 ANTI-ZIC3 antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412632 ANTI-ZIC3 antibody produced in mouse clone 2D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412633 ANTI-ZIC3 antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412634 ANTI-ZIC3 antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2701058 Anti-ZIC3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA052936 Anti-ZIC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA047934 Anti-ZIC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0007547M5 Monoclonal Anti-ZIC3 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404539 Monoclonal Anti-ZIC3 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003413 Rosetta Predictions human pricing
NM_001109019 Rosetta Predictions rat pricing
NM_009575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182052 predicted 1793
2 SASI_Hs01_00182053 predicted 2181
3 SASI_Hs01_00182054 predicted 2016
4 SASI_Hs01_00182055 predicted 2002
5 SASI_Hs01_00182056 predicted 1918
6 SASI_Hs01_00182057 predicted 2207
7 SASI_Hs01_00182058 predicted 1775
8 SASI_Hs01_00182059 predicted 1225
9 SASI_Hs01_00182060 predicted 1728
10 SASI_Hs01_00182061 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244374 predicted 1389
2 SASI_Rn02_00244375 predicted 1659
3 SASI_Rn02_00244376 predicted 1665
4 SASI_Rn02_00244377 predicted 1187
5 SASI_Rn02_00244378 predicted 1662
6 SASI_Rn02_00244379 predicted 1335
7 SASI_Rn02_00244380 predicted 1254
8 SASI_Rn02_00244381 predicted 1419
9 SASI_Rn02_00244382 predicted 1730
10 SASI_Rn02_00244383 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084775 predicted 2316
2 SASI_Mm01_00084776 predicted 2035
3 SASI_Mm01_00084777 predicted 2439
4 SASI_Mm01_00084778 predicted 2342
5 SASI_Mm02_00316466 predicted 2383
6 SASI_Mm01_00084779 predicted 2036
7 SASI_Mm01_00084781 predicted 1815
8 SASI_Mm02_00316467 predicted 2386
9 SASI_Mm01_00084782 predicted 1780
10 SASI_Mm01_00084783 predicted 1768
11 SASI_Mm01_00084780 predicted 2372
12 SASI_Mm01_00084784 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009575
ZIC3 MISSION shRNA Bacterial Glycerol Stock
Zic family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009575.1-2398s1c1
Sequence:CCGGCGAAACTTGTTGTTCAGTATTCTCGAGAATACTGAACAACAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1835s1c1
Sequence:CCGGGCTTCTGCAAACAGTAAAGATCTCGAGATCTTTACTGTTTGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1001s1c1
Sequence:CCGGCCTCCTAGCTACTTGCTCTTTCTCGAGAAAGAGCAAGTAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1900s1c1
Sequence:CCGGCCCTGGACTTCCTCCCAATTTCTCGAGAAATTGGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1361s1c1
Sequence:CCGGCATGAGTTGGTTACGCATGTTCTCGAGAACATGCGTAACCAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009575
ZIC3 MISSION shRNA shRNA Plasmid DNA
Zic family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009575.1-2398s1c1
Sequence:CCGGCGAAACTTGTTGTTCAGTATTCTCGAGAATACTGAACAACAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1835s1c1
Sequence:CCGGGCTTCTGCAAACAGTAAAGATCTCGAGATCTTTACTGTTTGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1001s1c1
Sequence:CCGGCCTCCTAGCTACTTGCTCTTTCTCGAGAAAGAGCAAGTAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1900s1c1
Sequence:CCGGCCCTGGACTTCCTCCCAATTTCTCGAGAAATTGGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1361s1c1
Sequence:CCGGCATGAGTTGGTTACGCATGTTCTCGAGAACATGCGTAACCAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009575
ZIC3 MISSION shRNA Lentiviral Transduction Particles
Zic family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009575.1-2398s1c1
Sequence:CCGGCGAAACTTGTTGTTCAGTATTCTCGAGAATACTGAACAACAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1835s1c1
Sequence:CCGGGCTTCTGCAAACAGTAAAGATCTCGAGATCTTTACTGTTTGCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1001s1c1
Sequence:CCGGCCTCCTAGCTACTTGCTCTTTCTCGAGAAAGAGCAAGTAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1900s1c1
Sequence:CCGGCCCTGGACTTCCTCCCAATTTCTCGAGAAATTGGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009575.1-1361s1c1
Sequence:CCGGCATGAGTTGGTTACGCATGTTCTCGAGAACATGCGTAACCAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003413
VALIDATED
ZIC3 MISSION shRNA Bacterial Glycerol Stock
Zic family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003413.2-2368s1c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1870s1c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1764s1c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1423s1c1
Sequence:CCGGCAAGTCTTTCAAGGCGAAGTACTCGAGTACTTCGCCTTGAAAGACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003413.2-1525s1c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1870s21c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1525s21c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003413.3-2368s21c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1764s21c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003413
VALIDATED
ZIC3 MISSION shRNA shRNA Plasmid DNA
Zic family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003413.2-2368s1c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1870s1c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1764s1c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1423s1c1
Sequence:CCGGCAAGTCTTTCAAGGCGAAGTACTCGAGTACTTCGCCTTGAAAGACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003413.2-1525s1c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1870s21c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1525s21c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003413.3-2368s21c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1764s21c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003413
VALIDATED
ZIC3 MISSION shRNA Lentiviral Transduction Particles
Zic family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003413.2-2368s1c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1870s1c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1764s1c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003413.2-1423s1c1
Sequence:CCGGCAAGTCTTTCAAGGCGAAGTACTCGAGTACTTCGCCTTGAAAGACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003413.2-1525s1c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1870s21c1
Sequence:CCGGCCCTGGACTTCCTCCTAATTTCTCGAGAAATTAGGAGGAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1525s21c1
Sequence:CCGGCCGTTCTGAGAACCTCAAGATCTCGAGATCTTGAGGTTCTCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003413.3-2368s21c1
Sequence:CCGGGCATTACACTTGTGAATGTATCTCGAGATACATTCACAAGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003413.3-1764s21c1
Sequence:CCGGCTGCCAGTTCAGGCTATGAATCTCGAGATTCATAGCCTGAACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks