EMAIL THIS PAGE TO A FRIEND

ZIC4

Zic family member 4

Gene ID:
Human(84107) Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
Mouse(22774) zinc finger protein of the cerebellum 4
Rat(315882) Zic family member 4
naked mole-rat(101712065) Zic family member 4
cow(539312) Zic family member 4
sheep(101102113) Zic family member 4
Zebrafish(767673) zic family member 4
chicken(424885) Zic family member 4
dog(485704) Zic family member 4
domestic cat(101083443) Zic family member 4
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105667 Anti-ZIC4 (11-24) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105668 Anti-ZIC4 (195-305) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA030194 Anti-ZIC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104489 Anti-ZIC4 antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, rat, mouse, horse
western blot pricing
SAB2103096 Anti-ZIC4, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, bovine, human, mouse, rat, rabbit
western blot pricing
WH0084107M1 Monoclonal Anti-ZIC4 antibody produced in mouse clone 4B1, purified immunoglobulin, buffered aqueous solution mouse
pricing
SAB1405302 Monoclonal Anti-ZIC4 antibody produced in mouse clone 1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409879 Monoclonal Anti-ZIC4 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409880 Monoclonal Anti-ZIC4 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409881 Monoclonal Anti-ZIC4 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409882 Monoclonal Anti-ZIC4 antibody produced in mouse clone 3G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409883 Monoclonal Anti-ZIC4 antibody produced in mouse clone 4F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137431 MISSION® esiRNA esiRNA human ZIC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032153 Rosetta Predictions human pricing
NM_001108176 Rosetta Predictions rat pricing
NM_009576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359388 predicted 1432
2 SASI_Hs02_00359389 predicted 1714
3 SASI_Hs01_00140297 predicted 570
4 SASI_Hs02_00359390 predicted 1600
5 SASI_Hs01_00140298 predicted 1714
6 SASI_Hs01_00140301 predicted 1598
7 SASI_Hs02_00359391 predicted 640
8 SASI_Hs01_00140303 predicted 1486
9 SASI_Hs01_00140304 predicted 1262
10 SASI_Hs01_00140305 predicted 1265
11 SASI_Hs01_00140299 predicted 1403
12 SASI_Hs01_00140300 predicted 304
13 SASI_Hs01_00140302 predicted 310
14 SASI_Hs01_00140306 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236094 predicted 461
2 SASI_Rn02_00236095 predicted 267
3 SASI_Rn02_00236096 predicted 730
4 SASI_Rn02_00236097 predicted 285
5 SASI_Rn02_00236098 predicted 424
6 SASI_Rn02_00236099 predicted 389
7 SASI_Rn02_00236100 predicted 506
8 SASI_Rn02_00236101 predicted 490
9 SASI_Rn02_00236102 predicted 382
10 SASI_Rn02_00236103 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316468 predicted 1314
2 SASI_Mm01_00056495 predicted 1268
3 SASI_Mm01_00056496 predicted 1390
4 SASI_Mm01_00056497 predicted 567
5 SASI_Mm01_00056498 predicted 1373
6 SASI_Mm01_00056499 predicted 823
7 SASI_Mm01_00056501 predicted 1317
8 SASI_Mm01_00056502 predicted 1379
9 SASI_Mm01_00056503 predicted 1466
10 SASI_Mm01_00056504 predicted 1348
11 SASI_Mm01_00056500 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032153
ZIC4 MISSION shRNA Bacterial Glycerol Stock
Zic family member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1488s21c1
Sequence:CCGGGACATAATATTTACGTCTAACCTCGAGGTTAGACGTAAATATTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032153.4-907s21c1
Sequence:CCGGGGGAAGGTCTTTGCTAGATCACTCGAGTGATCTAGCAAAGACCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1604s21c1
Sequence:CCGGGGCACTTGTACCCGATCATAACTCGAGTTATGATCGGGTACAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032153.3-3285s1c1
Sequence:CCGGGCCGTTAATAAGAAGGAGAATCTCGAGATTCTCCTTCTTATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-326s1c1
Sequence:CCGGACACTCTTAAAGAGTCAAGTACTCGAGTACTTGACTCTTTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-1157s1c1
Sequence:CCGGGCTCTGGCTACGATTCGGCTACTCGAGTAGCCGAATCGTAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-822s1c1
Sequence:CCGGGCCCTTCAAAGCCAAATACAACTCGAGTTGTATTTGGCTTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-315s1c1
Sequence:CCGGGCTTTACCGAAACACTCTTAACTCGAGTTAAGAGTGTTTCGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032153
ZIC4 MISSION shRNA shRNA Plasmid DNA
Zic family member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1488s21c1
Sequence:CCGGGACATAATATTTACGTCTAACCTCGAGGTTAGACGTAAATATTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032153.4-907s21c1
Sequence:CCGGGGGAAGGTCTTTGCTAGATCACTCGAGTGATCTAGCAAAGACCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1604s21c1
Sequence:CCGGGGCACTTGTACCCGATCATAACTCGAGTTATGATCGGGTACAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032153.3-3285s1c1
Sequence:CCGGGCCGTTAATAAGAAGGAGAATCTCGAGATTCTCCTTCTTATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-326s1c1
Sequence:CCGGACACTCTTAAAGAGTCAAGTACTCGAGTACTTGACTCTTTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-1157s1c1
Sequence:CCGGGCTCTGGCTACGATTCGGCTACTCGAGTAGCCGAATCGTAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-822s1c1
Sequence:CCGGGCCCTTCAAAGCCAAATACAACTCGAGTTGTATTTGGCTTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-315s1c1
Sequence:CCGGGCTTTACCGAAACACTCTTAACTCGAGTTAAGAGTGTTTCGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032153
ZIC4 MISSION shRNA Lentiviral Transduction Particles
Zic family member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1488s21c1
Sequence:CCGGGACATAATATTTACGTCTAACCTCGAGGTTAGACGTAAATATTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032153.4-907s21c1
Sequence:CCGGGGGAAGGTCTTTGCTAGATCACTCGAGTGATCTAGCAAAGACCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032153.4-1604s21c1
Sequence:CCGGGGCACTTGTACCCGATCATAACTCGAGTTATGATCGGGTACAAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032153.3-3285s1c1
Sequence:CCGGGCCGTTAATAAGAAGGAGAATCTCGAGATTCTCCTTCTTATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-326s1c1
Sequence:CCGGACACTCTTAAAGAGTCAAGTACTCGAGTACTTGACTCTTTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-1157s1c1
Sequence:CCGGGCTCTGGCTACGATTCGGCTACTCGAGTAGCCGAATCGTAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-822s1c1
Sequence:CCGGGCCCTTCAAAGCCAAATACAACTCGAGTTGTATTTGGCTTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032153.3-315s1c1
Sequence:CCGGGCTTTACCGAAACACTCTTAACTCGAGTTAAGAGTGTTTCGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009576
ZIC4 MISSION shRNA Bacterial Glycerol Stock
Zic family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-570s1c1
Sequence:CCGGGCACGTTATTTGTCTCGACAACTCGAGTTGTCGAGACAAATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1024s1c1
Sequence:CCGGGCAGGCTAACCACATTTGCTTCTCGAGAAGCAAATGTGGTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1303s1c1
Sequence:CCGGCGACAAGCCTTATATGTGCAACTCGAGTTGCACATATAAGGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-558s1c1
Sequence:CCGGACCGCTTCTCATGCACGTTATCTCGAGATAACGTGCATGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-559s1c1
Sequence:CCGGCCGCTTCTCATGCACGTTATTCTCGAGAATAACGTGCATGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009576
ZIC4 MISSION shRNA shRNA Plasmid DNA
Zic family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-570s1c1
Sequence:CCGGGCACGTTATTTGTCTCGACAACTCGAGTTGTCGAGACAAATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1024s1c1
Sequence:CCGGGCAGGCTAACCACATTTGCTTCTCGAGAAGCAAATGTGGTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1303s1c1
Sequence:CCGGCGACAAGCCTTATATGTGCAACTCGAGTTGCACATATAAGGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-558s1c1
Sequence:CCGGACCGCTTCTCATGCACGTTATCTCGAGATAACGTGCATGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-559s1c1
Sequence:CCGGCCGCTTCTCATGCACGTTATTCTCGAGAATAACGTGCATGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009576
ZIC4 MISSION shRNA Lentiviral Transduction Particles
Zic family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-570s1c1
Sequence:CCGGGCACGTTATTTGTCTCGACAACTCGAGTTGTCGAGACAAATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1024s1c1
Sequence:CCGGGCAGGCTAACCACATTTGCTTCTCGAGAAGCAAATGTGGTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-1303s1c1
Sequence:CCGGCGACAAGCCTTATATGTGCAACTCGAGTTGCACATATAAGGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-558s1c1
Sequence:CCGGACCGCTTCTCATGCACGTTATCTCGAGATAACGTGCATGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009576.1-559s1c1
Sequence:CCGGCCGCTTCTCATGCACGTTATTCTCGAGAATAACGTGCATGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks