EMAIL THIS PAGE TO A FRIEND

ZIC5

Zic family member 5

UniProtKB ID: Q96T25, Q5VYB0
Gene ID:
Human(85416) Summary: This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
Mouse(65100) zinc finger protein of the cerebellum 5
Rat(361095) Zic family member 5
Zebrafish(403041) zic family member 5 (odd-paired homolog, Drosophila)
dog(612986) Zic family member 5
cow(787451) Zic family member 5
sheep(101112236) Zic family member 5
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107906 Anti-ZIC5 antibody produced in rabbit affinity isolated antibody pig, human, zebrafish, canine, rat, mouse, guinea pig
western blot pricing
AV33669 Anti-ZIC5 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, mouse, human, rat,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033132 Rosetta Predictions human pricing
NM_001108391 Rosetta Predictions rat pricing
NM_022987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124776 predicted 354
2 SASI_Hs01_00124778 predicted 1952
3 SASI_Hs02_00360863 predicted 291
4 SASI_Hs01_00124779 predicted 1826
5 SASI_Hs02_00360864 predicted 290
6 SASI_Hs01_00124780 predicted 1917
7 SASI_Hs01_00124781 predicted 1772
8 SASI_Hs01_00124782 predicted 1839
9 SASI_Hs01_00124783 predicted 1905
10 SASI_Hs01_00124784 predicted 365
11 SASI_Hs01_00124777 predicted 1845
12 SASI_Hs01_00124785 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238199 predicted 1392
2 SASI_Rn02_00238200 predicted 812
3 SASI_Rn02_00238201 predicted 1389
4 SASI_Rn02_00238202 predicted 946
5 SASI_Rn02_00238203 predicted 1199
6 SASI_Rn02_00238204 predicted 1228
7 SASI_Rn02_00238205 predicted 1238
8 SASI_Rn02_00238206 predicted 735
9 SASI_Rn02_00238207 predicted 951
10 SASI_Rn02_00238208 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060424 predicted 402
2 SASI_Mm01_00060425 predicted 2163
3 SASI_Mm01_00060426 predicted 1828
4 SASI_Mm01_00060427 predicted 2151
5 SASI_Mm01_00060428 predicted 1823
6 SASI_Mm01_00060429 predicted 2093
7 SASI_Mm01_00060430 predicted 1945
8 SASI_Mm01_00060431 predicted 1898
9 SASI_Mm01_00060432 predicted 1806
10 SASI_Mm01_00060433 predicted 1653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022987
ZIC5 MISSION shRNA Bacterial Glycerol Stock
Zic family member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022987.1-2275s1c1
Sequence:CCGGCCATGTCCTAACCTGAAACAACTCGAGTTGTTTCAGGTTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1849s1c1
Sequence:CCGGGATCGAAAGAAACACTCCCATCTCGAGATGGGAGTGTTTCTTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-2206s1c1
Sequence:CCGGCCTGAAGTCATGCGGACGATACTCGAGTATCGTCCGCATGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1898s1c1
Sequence:CCGGGTAAGATTCGAGGCTGTGATACTCGAGTATCACAGCCTCGAATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-441s1c1
Sequence:CCGGGCTTCAGAATATGACAGGCTTCTCGAGAAGCCTGTCATATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2304s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-377s21c1
Sequence:CCGGAGCGCTGAGATTAGCGGATTTCTCGAGAAATCCGCTAATCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2218s21c1
Sequence:CCGGATTAATAAGTGAGGTAGTAAGCTCGAGCTTACTACCTCACTTATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-1745s21c1
Sequence:CCGGGATCCACAAGCGCACTCATACCTCGAGGTATGAGTGCGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022987
ZIC5 MISSION shRNA shRNA Plasmid DNA
Zic family member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022987.1-2275s1c1
Sequence:CCGGCCATGTCCTAACCTGAAACAACTCGAGTTGTTTCAGGTTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1849s1c1
Sequence:CCGGGATCGAAAGAAACACTCCCATCTCGAGATGGGAGTGTTTCTTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-2206s1c1
Sequence:CCGGCCTGAAGTCATGCGGACGATACTCGAGTATCGTCCGCATGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1898s1c1
Sequence:CCGGGTAAGATTCGAGGCTGTGATACTCGAGTATCACAGCCTCGAATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-441s1c1
Sequence:CCGGGCTTCAGAATATGACAGGCTTCTCGAGAAGCCTGTCATATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2304s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-377s21c1
Sequence:CCGGAGCGCTGAGATTAGCGGATTTCTCGAGAAATCCGCTAATCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2218s21c1
Sequence:CCGGATTAATAAGTGAGGTAGTAAGCTCGAGCTTACTACCTCACTTATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-1745s21c1
Sequence:CCGGGATCCACAAGCGCACTCATACCTCGAGGTATGAGTGCGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022987
ZIC5 MISSION shRNA Lentiviral Transduction Particles
Zic family member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022987.1-2275s1c1
Sequence:CCGGCCATGTCCTAACCTGAAACAACTCGAGTTGTTTCAGGTTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1849s1c1
Sequence:CCGGGATCGAAAGAAACACTCCCATCTCGAGATGGGAGTGTTTCTTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-2206s1c1
Sequence:CCGGCCTGAAGTCATGCGGACGATACTCGAGTATCGTCCGCATGACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-1898s1c1
Sequence:CCGGGTAAGATTCGAGGCTGTGATACTCGAGTATCACAGCCTCGAATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022987.1-441s1c1
Sequence:CCGGGCTTCAGAATATGACAGGCTTCTCGAGAAGCCTGTCATATTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2304s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-377s21c1
Sequence:CCGGAGCGCTGAGATTAGCGGATTTCTCGAGAAATCCGCTAATCTCAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022987.3-2218s21c1
Sequence:CCGGATTAATAAGTGAGGTAGTAAGCTCGAGCTTACTACCTCACTTATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022987.3-1745s21c1
Sequence:CCGGGATCCACAAGCGCACTCATACCTCGAGGTATGAGTGCGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033132
ZIC5 MISSION shRNA Bacterial Glycerol Stock
Zic family member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1858s1c1
Sequence:CCGGGATCGGAAGAAACATTCCCATCTCGAGATGGGAATGTTTCTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1233s1c1
Sequence:CCGGAGCCGTGAACTTAAACCTGAACTCGAGTTCAGGTTTAAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1845s1c1
Sequence:CCGGTGCCAATAGCAGTGATCGGAACTCGAGTTCCGATCACTGCTATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1665s1c1
Sequence:CCGGCAAGGCCAAATACAAGCTCATCTCGAGATGAGCTTGTATTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-2215s1c1
Sequence:CCGGCCTGAAGTTGTGCGGACGATACTCGAGTATCGTCCGCACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033132.3-1776s21c1
Sequence:CCGGGATCCACAAGCGTACTCATACCTCGAGGTATGAGTACGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2558s21c1
Sequence:CCGGACACACTGCCGATGCAATATACTCGAGTATATTGCATCGGCAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2342s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2532s21c1
Sequence:CCGGGAATGGAGAGATTAGTTAATGCTCGAGCATTAACTAATCTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033132
ZIC5 MISSION shRNA shRNA Plasmid DNA
Zic family member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1858s1c1
Sequence:CCGGGATCGGAAGAAACATTCCCATCTCGAGATGGGAATGTTTCTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1233s1c1
Sequence:CCGGAGCCGTGAACTTAAACCTGAACTCGAGTTCAGGTTTAAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1845s1c1
Sequence:CCGGTGCCAATAGCAGTGATCGGAACTCGAGTTCCGATCACTGCTATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1665s1c1
Sequence:CCGGCAAGGCCAAATACAAGCTCATCTCGAGATGAGCTTGTATTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-2215s1c1
Sequence:CCGGCCTGAAGTTGTGCGGACGATACTCGAGTATCGTCCGCACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033132.3-1776s21c1
Sequence:CCGGGATCCACAAGCGTACTCATACCTCGAGGTATGAGTACGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2558s21c1
Sequence:CCGGACACACTGCCGATGCAATATACTCGAGTATATTGCATCGGCAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2342s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2532s21c1
Sequence:CCGGGAATGGAGAGATTAGTTAATGCTCGAGCATTAACTAATCTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033132
ZIC5 MISSION shRNA Lentiviral Transduction Particles
Zic family member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1858s1c1
Sequence:CCGGGATCGGAAGAAACATTCCCATCTCGAGATGGGAATGTTTCTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1233s1c1
Sequence:CCGGAGCCGTGAACTTAAACCTGAACTCGAGTTCAGGTTTAAGTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1845s1c1
Sequence:CCGGTGCCAATAGCAGTGATCGGAACTCGAGTTCCGATCACTGCTATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-1665s1c1
Sequence:CCGGCAAGGCCAAATACAAGCTCATCTCGAGATGAGCTTGTATTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033132.2-2215s1c1
Sequence:CCGGCCTGAAGTTGTGCGGACGATACTCGAGTATCGTCCGCACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033132.3-1776s21c1
Sequence:CCGGGATCCACAAGCGTACTCATACCTCGAGGTATGAGTACGCTTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2558s21c1
Sequence:CCGGACACACTGCCGATGCAATATACTCGAGTATATTGCATCGGCAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2342s21c1
Sequence:CCGGACTTGCCACCGGGTCTAATTACTCGAGTAATTAGACCCGGTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033132.3-2532s21c1
Sequence:CCGGGAATGGAGAGATTAGTTAATGCTCGAGCATTAACTAATCTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks