EMAIL THIS PAGE TO A FRIEND

ZIK1

zinc finger protein interacting with K protein 1

Synonyms: ZNF762
UniProtKB ID: Q3SY52, O43339, Q3SY51, Q3SY53
Gene ID:
Mouse(22775) zinc finger protein interacting with K protein 1
Rat(100359821) zinc finger protein interacting with K protein 1 homolog (mouse)
naked mole-rat(101707334) zinc finger protein interacting with K protein 1
cow(789983) zinc finger protein 551-like
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010879 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151381 MISSION® esiRNA esiRNA human ZIK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010879 Rosetta Predictions human pricing
NM_009577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092858 predicted 579
2 SASI_Hs01_00092859 predicted 462
3 SASI_Hs01_00092860 predicted 1623
4 SASI_Hs01_00092861 predicted 717
5 SASI_Hs01_00092862 predicted 1552
6 SASI_Hs01_00092863 predicted 1646
7 SASI_Hs01_00092865 predicted 1306
8 SASI_Hs01_00092866 predicted 1342
9 SASI_Hs02_00305836 predicted 1593
10 SASI_Hs02_00305837 predicted 770
11 SASI_Hs01_00092864 predicted 565
12 SASI_Hs01_00092867 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186797 predicted 878
2 SASI_Mm01_00186798 predicted 303
3 SASI_Mm01_00186799 predicted 417
4 SASI_Mm02_00316469 predicted 990
5 SASI_Mm01_00186800 predicted 1420
6 SASI_Mm01_00186801 predicted 591
7 SASI_Mm01_00186802 predicted 441
8 SASI_Mm01_00186803 predicted 652
9 SASI_Mm02_00316470 predicted 327
10 SASI_Mm01_00186805 predicted 1071
11 SASI_Mm01_00186804 predicted 1082
12 SASI_Mm01_00186806 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010879
ZIK1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein interacting with K protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-539s21c1
Sequence:CCGGGACATGGACAGAGCCTCATATCTCGAGATATGAGGCTCTGTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-585s21c1
Sequence:CCGGCATTGAAGCCCTTTCGCAAATCTCGAGATTTGCGAAAGGGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010879.1-1739s1c1
Sequence:CCGGGCTCCTGAAAGTCCACACTTACTCGAGTAAGTGTGGACTTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-841s1c1
Sequence:CCGGGTCATTACAAGTCAGGTGAATCTCGAGATTCACCTGACTTGTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1222s1c1
Sequence:CCGGCCACCCTTGTTAAACACCAAACTCGAGTTTGGTGTTTAACAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1306s1c1
Sequence:CCGGCCATTCTTAATCAACACCGAACTCGAGTTCGGTGTTGATTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1642s1c1
Sequence:CCGGCCAGCCTCATACATCACCAAACTCGAGTTTGGTGATGTATGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010879
ZIK1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein interacting with K protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-539s21c1
Sequence:CCGGGACATGGACAGAGCCTCATATCTCGAGATATGAGGCTCTGTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-585s21c1
Sequence:CCGGCATTGAAGCCCTTTCGCAAATCTCGAGATTTGCGAAAGGGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010879.1-1739s1c1
Sequence:CCGGGCTCCTGAAAGTCCACACTTACTCGAGTAAGTGTGGACTTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-841s1c1
Sequence:CCGGGTCATTACAAGTCAGGTGAATCTCGAGATTCACCTGACTTGTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1222s1c1
Sequence:CCGGCCACCCTTGTTAAACACCAAACTCGAGTTTGGTGTTTAACAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1306s1c1
Sequence:CCGGCCATTCTTAATCAACACCGAACTCGAGTTCGGTGTTGATTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1642s1c1
Sequence:CCGGCCAGCCTCATACATCACCAAACTCGAGTTTGGTGATGTATGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010879
ZIK1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein interacting with K protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-539s21c1
Sequence:CCGGGACATGGACAGAGCCTCATATCTCGAGATATGAGGCTCTGTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010879.2-585s21c1
Sequence:CCGGCATTGAAGCCCTTTCGCAAATCTCGAGATTTGCGAAAGGGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010879.1-1739s1c1
Sequence:CCGGGCTCCTGAAAGTCCACACTTACTCGAGTAAGTGTGGACTTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-841s1c1
Sequence:CCGGGTCATTACAAGTCAGGTGAATCTCGAGATTCACCTGACTTGTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1222s1c1
Sequence:CCGGCCACCCTTGTTAAACACCAAACTCGAGTTTGGTGTTTAACAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1306s1c1
Sequence:CCGGCCATTCTTAATCAACACCGAACTCGAGTTCGGTGTTGATTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010879.1-1642s1c1
Sequence:CCGGCCAGCCTCATACATCACCAAACTCGAGTTTGGTGATGTATGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009577
ZIK1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein interacting with K protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1254s21c1
Sequence:CCGGTAGTCAAAGTGCCATTCTTAACTCGAGTTAAGAATGGCACTTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1018s21c1
Sequence:CCGGCTGAATGATCACCGTAGAATACTCGAGTATTCTACGGTGATCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-591s21c1
Sequence:CCGGTCAGCACCAAGACCATAATAGCTCGAGCTATTATGGTCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-442s21c1
Sequence:CCGGGTTTCTACACGAGCGTCAAAGCTCGAGCTTTGACGCTCGTGTAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009577.3-1983s21c1
Sequence:CCGGATGACCAGTGTGCAATGATTACTCGAGTAATCATTGCACACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009577.2-3317s1c1
Sequence:CCGGCGGACTTGTAAGTGTTGAATACTCGAGTATTCAACACTTACAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-335s1c1
Sequence:CCGGTGCAGAACTTTGCACTCATAACTCGAGTTATGAGTGCAAAGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-248s1c1
Sequence:CCGGCCTTTCAAGATGTGGCCATTTCTCGAGAAATGGCCACATCTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-336s1c1
Sequence:CCGGGCAGAACTTTGCACTCATAAACTCGAGTTTATGAGTGCAAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-877s1c1
Sequence:CCGGCGTGGCAAATACTCCCTTGATCTCGAGATCAAGGGAGTATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009577
ZIK1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein interacting with K protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1254s21c1
Sequence:CCGGTAGTCAAAGTGCCATTCTTAACTCGAGTTAAGAATGGCACTTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1018s21c1
Sequence:CCGGCTGAATGATCACCGTAGAATACTCGAGTATTCTACGGTGATCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-591s21c1
Sequence:CCGGTCAGCACCAAGACCATAATAGCTCGAGCTATTATGGTCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-442s21c1
Sequence:CCGGGTTTCTACACGAGCGTCAAAGCTCGAGCTTTGACGCTCGTGTAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009577.3-1983s21c1
Sequence:CCGGATGACCAGTGTGCAATGATTACTCGAGTAATCATTGCACACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009577.2-3317s1c1
Sequence:CCGGCGGACTTGTAAGTGTTGAATACTCGAGTATTCAACACTTACAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-335s1c1
Sequence:CCGGTGCAGAACTTTGCACTCATAACTCGAGTTATGAGTGCAAAGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-248s1c1
Sequence:CCGGCCTTTCAAGATGTGGCCATTTCTCGAGAAATGGCCACATCTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-336s1c1
Sequence:CCGGGCAGAACTTTGCACTCATAAACTCGAGTTTATGAGTGCAAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-877s1c1
Sequence:CCGGCGTGGCAAATACTCCCTTGATCTCGAGATCAAGGGAGTATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009577
ZIK1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein interacting with K protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1254s21c1
Sequence:CCGGTAGTCAAAGTGCCATTCTTAACTCGAGTTAAGAATGGCACTTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-1018s21c1
Sequence:CCGGCTGAATGATCACCGTAGAATACTCGAGTATTCTACGGTGATCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-591s21c1
Sequence:CCGGTCAGCACCAAGACCATAATAGCTCGAGCTATTATGGTCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009577.3-442s21c1
Sequence:CCGGGTTTCTACACGAGCGTCAAAGCTCGAGCTTTGACGCTCGTGTAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009577.3-1983s21c1
Sequence:CCGGATGACCAGTGTGCAATGATTACTCGAGTAATCATTGCACACTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009577.2-3317s1c1
Sequence:CCGGCGGACTTGTAAGTGTTGAATACTCGAGTATTCAACACTTACAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-335s1c1
Sequence:CCGGTGCAGAACTTTGCACTCATAACTCGAGTTATGAGTGCAAAGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-248s1c1
Sequence:CCGGCCTTTCAAGATGTGGCCATTTCTCGAGAAATGGCCACATCTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-336s1c1
Sequence:CCGGGCAGAACTTTGCACTCATAAACTCGAGTTTATGAGTGCAAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009577.2-877s1c1
Sequence:CCGGCGTGGCAAATACTCCCTTGATCTCGAGATCAAGGGAGTATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks