EMAIL THIS PAGE TO A FRIEND

ZIM2

zinc finger, imprinted 2

Synonyms: ZNF656
UniProtKB ID: Q9NZV7, Q2M3K1
Gene ID:
Human(23619) Summary: In human, ZIM2 and PEG3 (GeneID:5178) are two distinct genes that share a set of 5' exons and have a common promoter, and both genes are paternally expressed. Alternative splicing events connect the shared exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. This is in contrast to mouse and cow, where ZIM2 and PEG3 genes do not share exons in common, and the imprinting status of ZIM2 is also not conserved amongst mammals. Additional 5' alternatively spliced transcripts encoding the same protein have been found for the human ZIM2 gene. [provided by RefSeq, Oct 2010]
Mouse(76637) zinc finger, imprinted 2
naked mole-rat(101716361) zinc finger, imprinted 2
cow(444865) zinc finger, imprinted 2
sheep(101111997) zinc finger, imprinted 2
dog(484269) zinc finger, imprinted 2
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_489216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_489216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_489216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086591 MISSION® esiRNA esiRNA human ZIM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015363 Rosetta Predictions human pricing
XM_489216 Rosetta Predictions mouse pricing
XM_922461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088424 predicted 1075
2 SASI_Hs01_00088425 predicted 854
3 SASI_Hs01_00088426 predicted 1851
4 SASI_Hs01_00088427 predicted 1235
5 SASI_Hs01_00088428 predicted 1376
6 SASI_Hs01_00088429 predicted 1706
7 SASI_Hs01_00088431 predicted 1047
8 SASI_Hs01_00088432 predicted 1255
9 SASI_Hs01_00088433 predicted 1506
10 SASI_Hs02_00347699 predicted 1082
11 SASI_Hs01_00088430 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285432 predicted 731
2 SASI_Mm01_00285433 predicted 779
3 SASI_Mm01_00285434 predicted 709
4 SASI_Mm01_00285435 predicted 234
5 SASI_Mm01_00285437 predicted 716
6 SASI_Mm01_00285438 predicted 229
7 SASI_Mm02_00427207 predicted 589
8 SASI_Mm01_00285439 predicted 309
9 SASI_Mm01_00285440 predicted 283
10 SASI_Mm02_00427208 predicted 317
11 SASI_Mm01_00285431 predicted 277
12 SASI_Mm01_00285436 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443426 predicted 733
2 SASI_Mm02_00443427 predicted 777
3 SASI_Mm02_00443428 predicted 707
4 SASI_Mm02_00443429 predicted 237
5 SASI_Mm02_00443430 predicted 712
6 SASI_Mm02_00443431 predicted 227
7 SASI_Mm02_00443432 predicted 596
8 SASI_Mm02_00443433 predicted 309
9 SASI_Mm02_00443434 predicted 282
10 SASI_Mm02_00443435 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015363
ZIM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, imprinted 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-867s21c1
Sequence:CCGGTTCAAACACTTAGGAACATTTCTCGAGAAATGTTCCTAAGTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1714s21c1
Sequence:CCGGCCCACAGCAAGACATACTTAACTCGAGTTAAGTATGTCTTGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1571s21c1
Sequence:CCGGGAATCTCTGTGAACGTGTAAGCTCGAGCTTACACGTTCACAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1597s21c1
Sequence:CCGGACAGTCAGGAGGACTACTTTGCTCGAGCAAAGTAGTCCTCCTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1304s21c1
Sequence:CCGGAGGCACTGCTCCTGGAATATGCTCGAGCATATTCCAGGAGCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1214s1c1
Sequence:CCGGGCAGTGATGAATTTGAGAGAACTCGAGTTCTCTCAAATTCATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1892s1c1
Sequence:CCGGCTCAACATTATCAACTCCATTCTCGAGAATGGAGTTGATAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1366s1c1
Sequence:CCGGCGAACCTTTAGTACGCAAGTACTCGAGTACTTGCGTACTAAAGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1014s1c1
Sequence:CCGGCCAGTTCTCTAAACCTGACATCTCGAGATGTCAGGTTTAGAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-922s1c1
Sequence:CCGGCCAGAGGAACTTAGTTCCCTTCTCGAGAAGGGAACTAAGTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015363
ZIM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, imprinted 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-867s21c1
Sequence:CCGGTTCAAACACTTAGGAACATTTCTCGAGAAATGTTCCTAAGTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1714s21c1
Sequence:CCGGCCCACAGCAAGACATACTTAACTCGAGTTAAGTATGTCTTGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1571s21c1
Sequence:CCGGGAATCTCTGTGAACGTGTAAGCTCGAGCTTACACGTTCACAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1597s21c1
Sequence:CCGGACAGTCAGGAGGACTACTTTGCTCGAGCAAAGTAGTCCTCCTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1304s21c1
Sequence:CCGGAGGCACTGCTCCTGGAATATGCTCGAGCATATTCCAGGAGCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1214s1c1
Sequence:CCGGGCAGTGATGAATTTGAGAGAACTCGAGTTCTCTCAAATTCATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1892s1c1
Sequence:CCGGCTCAACATTATCAACTCCATTCTCGAGAATGGAGTTGATAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1366s1c1
Sequence:CCGGCGAACCTTTAGTACGCAAGTACTCGAGTACTTGCGTACTAAAGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1014s1c1
Sequence:CCGGCCAGTTCTCTAAACCTGACATCTCGAGATGTCAGGTTTAGAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-922s1c1
Sequence:CCGGCCAGAGGAACTTAGTTCCCTTCTCGAGAAGGGAACTAAGTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015363
ZIM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, imprinted 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-867s21c1
Sequence:CCGGTTCAAACACTTAGGAACATTTCTCGAGAAATGTTCCTAAGTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1714s21c1
Sequence:CCGGCCCACAGCAAGACATACTTAACTCGAGTTAAGTATGTCTTGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1571s21c1
Sequence:CCGGGAATCTCTGTGAACGTGTAAGCTCGAGCTTACACGTTCACAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1597s21c1
Sequence:CCGGACAGTCAGGAGGACTACTTTGCTCGAGCAAAGTAGTCCTCCTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015363.4-1304s21c1
Sequence:CCGGAGGCACTGCTCCTGGAATATGCTCGAGCATATTCCAGGAGCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1214s1c1
Sequence:CCGGGCAGTGATGAATTTGAGAGAACTCGAGTTCTCTCAAATTCATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1892s1c1
Sequence:CCGGCTCAACATTATCAACTCCATTCTCGAGAATGGAGTTGATAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1366s1c1
Sequence:CCGGCGAACCTTTAGTACGCAAGTACTCGAGTACTTGCGTACTAAAGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-1014s1c1
Sequence:CCGGCCAGTTCTCTAAACCTGACATCTCGAGATGTCAGGTTTAGAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015363.3-922s1c1
Sequence:CCGGCCAGAGGAACTTAGTTCCCTTCTCGAGAAGGGAACTAAGTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_489216
ZIM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, imprinted 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_489216.4-500s21c1
Sequence:CCGGTCTGATGACAAGTCGGAATTGCTCGAGCAATTCCGACTTGTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-207s21c1
Sequence:CCGGGATTGGAGGAGGAGGAGTTAGCTCGAGCTAACTCCTCCTCCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-233s21c1
Sequence:CCGGTGCAGAACAACGTGTACTTTACTCGAGTAAAGTACACGTTGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-181s21c1
Sequence:CCGGCAAGAGCTGGTGACCTTTAAGCTCGAGCTTAAAGGTCACCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_489216
ZIM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, imprinted 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_489216.4-500s21c1
Sequence:CCGGTCTGATGACAAGTCGGAATTGCTCGAGCAATTCCGACTTGTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-207s21c1
Sequence:CCGGGATTGGAGGAGGAGGAGTTAGCTCGAGCTAACTCCTCCTCCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-233s21c1
Sequence:CCGGTGCAGAACAACGTGTACTTTACTCGAGTAAAGTACACGTTGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-181s21c1
Sequence:CCGGCAAGAGCTGGTGACCTTTAAGCTCGAGCTTAAAGGTCACCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_489216
ZIM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, imprinted 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_489216.4-500s21c1
Sequence:CCGGTCTGATGACAAGTCGGAATTGCTCGAGCAATTCCGACTTGTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-207s21c1
Sequence:CCGGGATTGGAGGAGGAGGAGTTAGCTCGAGCTAACTCCTCCTCCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-233s21c1
Sequence:CCGGTGCAGAACAACGTGTACTTTACTCGAGTAAAGTACACGTTGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_489216.4-181s21c1
Sequence:CCGGCAAGAGCTGGTGACCTTTAAGCTCGAGCTTAAAGGTCACCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks