EMAIL THIS PAGE TO A FRIEND

ZIM3

zinc finger, imprinted 3

Synonyms: ZNF657
UniProtKB ID: Q96PE6, Q14CA6
Gene ID:
Mouse(116811) zinc finger, imprinted 3
sheep(101112758) zinc finger, imprinted 3
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052882 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205685 predicted 1459
2 SASI_Hs01_00205686 predicted 1719
3 SASI_Hs02_00361591 predicted 1719
4 SASI_Hs01_00205687 predicted 631
5 SASI_Hs01_00205689 predicted 1253
6 SASI_Hs02_00361592 predicted 1419
7 SASI_Hs01_00205690 predicted 909
8 SASI_Hs01_00205691 predicted 1592
9 SASI_Hs01_00205694 predicted 881
10 SASI_Hs02_00361593 predicted 1630
11 SASI_Hs01_00205688 predicted 850
12 SASI_Hs01_00205692 predicted 1087
13 SASI_Hs01_00205693 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052882
ZIM3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, imprinted 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1077s1c1
Sequence:CCGGGCCTACAAGCAGAAGTCAAATCTCGAGATTTGACTTCTGCTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1168s1c1
Sequence:CCGGCCTGGAAATCATCCTGCATTACTCGAGTAATGCAGGATGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1329s1c1
Sequence:CCGGGCTTTCATTTACAAGTCAGATCTCGAGATCTGACTTGTAAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-724s1c1
Sequence:CCGGCTACGCAGAAAGGTGTAGAATCTCGAGATTCTACACCTTTCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-861s1c1
Sequence:CCGGCCATCCAAATTTGTAGGACAACTCGAGTTGTCCTACAAATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-692s21c1
Sequence:CCGGAGAAGTCCCATCAATCAATAACTCGAGTTATTGATTGATGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-1906s21c1
Sequence:CCGGGAAGGTAGCGAGGACTTATTACTCGAGTAATAAGTCCTCGCTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-2092s21c1
Sequence:CCGGATGACCAGTGGTATCCATATCCTCGAGGATATGGATACCACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1729s21c1
Sequence:CCGGGATGTTCTGAATGCGGTAAAGCTCGAGCTTTACCGCATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1036s21c1
Sequence:CCGGACGCAGAGGAAAGGCCCTATACTCGAGTATAGGGCCTTTCCTCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052882
ZIM3 MISSION shRNA shRNA Plasmid DNA
zinc finger, imprinted 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1077s1c1
Sequence:CCGGGCCTACAAGCAGAAGTCAAATCTCGAGATTTGACTTCTGCTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1168s1c1
Sequence:CCGGCCTGGAAATCATCCTGCATTACTCGAGTAATGCAGGATGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1329s1c1
Sequence:CCGGGCTTTCATTTACAAGTCAGATCTCGAGATCTGACTTGTAAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-724s1c1
Sequence:CCGGCTACGCAGAAAGGTGTAGAATCTCGAGATTCTACACCTTTCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-861s1c1
Sequence:CCGGCCATCCAAATTTGTAGGACAACTCGAGTTGTCCTACAAATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-692s21c1
Sequence:CCGGAGAAGTCCCATCAATCAATAACTCGAGTTATTGATTGATGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-1906s21c1
Sequence:CCGGGAAGGTAGCGAGGACTTATTACTCGAGTAATAAGTCCTCGCTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-2092s21c1
Sequence:CCGGATGACCAGTGGTATCCATATCCTCGAGGATATGGATACCACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1729s21c1
Sequence:CCGGGATGTTCTGAATGCGGTAAAGCTCGAGCTTTACCGCATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1036s21c1
Sequence:CCGGACGCAGAGGAAAGGCCCTATACTCGAGTATAGGGCCTTTCCTCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052882
ZIM3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, imprinted 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1077s1c1
Sequence:CCGGGCCTACAAGCAGAAGTCAAATCTCGAGATTTGACTTCTGCTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1168s1c1
Sequence:CCGGCCTGGAAATCATCCTGCATTACTCGAGTAATGCAGGATGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-1329s1c1
Sequence:CCGGGCTTTCATTTACAAGTCAGATCTCGAGATCTGACTTGTAAATGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-724s1c1
Sequence:CCGGCTACGCAGAAAGGTGTAGAATCTCGAGATTCTACACCTTTCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052882.1-861s1c1
Sequence:CCGGCCATCCAAATTTGTAGGACAACTCGAGTTGTCCTACAAATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-692s21c1
Sequence:CCGGAGAAGTCCCATCAATCAATAACTCGAGTTATTGATTGATGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-1906s21c1
Sequence:CCGGGAAGGTAGCGAGGACTTATTACTCGAGTAATAAGTCCTCGCTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052882.1-2092s21c1
Sequence:CCGGATGACCAGTGGTATCCATATCCTCGAGGATATGGATACCACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1729s21c1
Sequence:CCGGGATGTTCTGAATGCGGTAAAGCTCGAGCTTTACCGCATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052882.1-1036s21c1
Sequence:CCGGACGCAGAGGAAAGGCCCTATACTCGAGTATAGGGCCTTTCCTCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks