EMAIL THIS PAGE TO A FRIEND

ZKSCAN1

zinc finger with KRAB and SCAN domains 1

Synonyms: 9130423L19Rik KOX18 PHZ-37 ZNF139 ZNF36 ZSCAN33
UniProtKB ID: P17029, A4D294, P52745, Q2M1U1, Q8TBW5, Q8TEK7
Gene ID:
Human(7586) Summary: The ZKSCAN1 gene encodes a transcriptional regulator of the KRAB (Kruppel-associated box) subfamily of zinc finger proteins, which contain repeated Cys2-His2 (C2H2) zinc finger domains that are connected by conserved sequences, called H/C links (summarized by Tommerup and Vissing, 1995 [PubMed 7557990]
Mouse(74570) zinc finger with KRAB and SCAN domains 1
Rat(498160) zinc finger with KRAB and SCAN domains 1
domestic cat(101086109) zinc finger with KRAB and SCAN domains 1
Horse(100067222) zinc finger with KRAB and SCAN domains 1
dog(489849) zinc finger with KRAB and SCAN domains 1
cow(100140434) zinc finger with KRAB and SCAN domains 1
sheep(101110474) zinc finger with KRAB and SCAN domains 1
naked mole-rat(101696934) zinc finger with KRAB and SCAN domains 1
domestic guinea pig(100720521) zinc finger with KRAB and SCAN domains 1
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_168302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_168302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_168302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003439 Rosetta Predictions human pricing
NM_001025760 Rosetta Predictions rat pricing
NM_029869 Rosetta Predictions mouse pricing
NM_133906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085004 predicted 1193
2 SASI_Hs01_00085005 predicted 981
3 SASI_Hs01_00085006 predicted 1875
4 SASI_Hs01_00085007 predicted 1280
5 SASI_Hs01_00085008 predicted 1209
6 SASI_Hs01_00085009 predicted 1459
7 SASI_Hs01_00085012 predicted 1706
8 SASI_Hs01_00085013 predicted 395
9 SASI_Hs02_00335661 predicted 1022
10 SASI_Hs02_00335662 predicted 1380
11 SASI_Hs01_00085010 predicted 983
12 SASI_Hs01_00085011 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039293 predicted 1503
2 SASI_Rn01_00039294 predicted 1505
3 SASI_Rn01_00039295 predicted 1800
4 SASI_Rn01_00039296 predicted 1783
5 SASI_Rn01_00039297 predicted 231
6 SASI_Rn01_00039298 predicted 248
7 SASI_Rn01_00039299 predicted 401
8 SASI_Rn02_00203430 predicted 1322
9 SASI_Rn02_00203431 predicted 1298
10 SASI_Rn01_00039300 predicted 1106
11 SASI_Rn01_00039301 predicted 1799
12 SASI_Rn01_00039302 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336103 predicted 437
2 SASI_Mm01_00194278 predicted 1621
3 SASI_Mm01_00194280 predicted 340
4 SASI_Mm01_00194281 predicted 1486
5 SASI_Mm01_00194282 predicted 1763
6 SASI_Mm01_00194283 predicted 1067
7 SASI_Mm01_00194284 predicted 1333
8 SASI_Mm01_00194285 predicted 1684
9 SASI_Mm01_00194286 predicted 1738
10 SASI_Mm01_00194287 predicted 408
11 SASI_Mm01_00194279 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338963 predicted 446
2 SASI_Mm01_00092422 predicted 1848
3 SASI_Mm01_00092424 predicted 346
4 SASI_Mm01_00092425 predicted 1713
5 SASI_Mm01_00092426 predicted 1992
6 SASI_Mm01_00092427 predicted 1292
7 SASI_Mm01_00092428 predicted 1554
8 SASI_Mm01_00092429 predicted 1909
9 SASI_Mm01_00092430 predicted 1963
10 SASI_Mm01_00092431 predicted 415
11 SASI_Mm01_00092423 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133906
ZKSCAN1 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-877s21c1
Sequence:CCGGTGCACTATTGACCGCAGATTCCTCGAGGAATCTGCGGTCAATAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1397s21c1
Sequence:CCGGTCAAGCCTTATCCGCCATAAACTCGAGTTTATGGCGGATAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.4-4559s1c1
Sequence:CCGGGTTAGTGCTCAGGCTAGTTAACTCGAGTTAACTAGCCTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133906.4-2885s21c1
Sequence:CCGGACCTACAGGACATGCTATAATCTCGAGATTATAGCATGTCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-448s21c1
Sequence:CCGGAGAAGCTTTGAATCGACTAAACTCGAGTTTAGTCGATTCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1725s21c1
Sequence:CCGGACCGAAACTCATACCTTATTTCTCGAGAAATAAGGTATGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-560s1c1
Sequence:CCGGGAAGACTTGGAACTTGATCTACTCGAGTAGATCAAGTTCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.3-2571s1c1
Sequence:CCGGCCACAAAGTTAGCACTTGATTCTCGAGAATCAAGTGCTAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-1489s1c1
Sequence:CCGGCCATAGCTCAAATCTCATCCTCTCGAGAGGATGAGATTTGAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133906
ZKSCAN1 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-877s21c1
Sequence:CCGGTGCACTATTGACCGCAGATTCCTCGAGGAATCTGCGGTCAATAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1397s21c1
Sequence:CCGGTCAAGCCTTATCCGCCATAAACTCGAGTTTATGGCGGATAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.4-4559s1c1
Sequence:CCGGGTTAGTGCTCAGGCTAGTTAACTCGAGTTAACTAGCCTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133906.4-2885s21c1
Sequence:CCGGACCTACAGGACATGCTATAATCTCGAGATTATAGCATGTCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-448s21c1
Sequence:CCGGAGAAGCTTTGAATCGACTAAACTCGAGTTTAGTCGATTCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1725s21c1
Sequence:CCGGACCGAAACTCATACCTTATTTCTCGAGAAATAAGGTATGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-560s1c1
Sequence:CCGGGAAGACTTGGAACTTGATCTACTCGAGTAGATCAAGTTCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.3-2571s1c1
Sequence:CCGGCCACAAAGTTAGCACTTGATTCTCGAGAATCAAGTGCTAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-1489s1c1
Sequence:CCGGCCATAGCTCAAATCTCATCCTCTCGAGAGGATGAGATTTGAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133906
ZKSCAN1 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-877s21c1
Sequence:CCGGTGCACTATTGACCGCAGATTCCTCGAGGAATCTGCGGTCAATAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1397s21c1
Sequence:CCGGTCAAGCCTTATCCGCCATAAACTCGAGTTTATGGCGGATAAGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.4-4559s1c1
Sequence:CCGGGTTAGTGCTCAGGCTAGTTAACTCGAGTTAACTAGCCTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133906.4-2885s21c1
Sequence:CCGGACCTACAGGACATGCTATAATCTCGAGATTATAGCATGTCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-448s21c1
Sequence:CCGGAGAAGCTTTGAATCGACTAAACTCGAGTTTAGTCGATTCAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133906.4-1725s21c1
Sequence:CCGGACCGAAACTCATACCTTATTTCTCGAGAAATAAGGTATGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-560s1c1
Sequence:CCGGGAAGACTTGGAACTTGATCTACTCGAGTAGATCAAGTTCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133906.3-2571s1c1
Sequence:CCGGCCACAAAGTTAGCACTTGATTCTCGAGAATCAAGTGCTAACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133906.3-1489s1c1
Sequence:CCGGCCATAGCTCAAATCTCATCCTCTCGAGAGGATGAGATTTGAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_168302
ZKSCAN1 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1331s1c1
Sequence:CCGGCGGGAACAAAGTCTCACAGATCTCGAGATCTGTGAGACTTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-475s1c1
Sequence:CCGGCCAGAAATAAACACCAAGGAACTCGAGTTCCTTGGTGTTTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-863s1c1
Sequence:CCGGCTGCACTATTCACAGCGGATTCTCGAGAATCCGCTGTGAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-397s1c1
Sequence:CCGGCGCTTCTGTTACCAGAACACTCTCGAGAGTGTTCTGGTAACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1710s1c1
Sequence:CCGGCAACCGAAACTCATACCTGATCTCGAGATCAGGTATGAGTTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_168302
ZKSCAN1 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1331s1c1
Sequence:CCGGCGGGAACAAAGTCTCACAGATCTCGAGATCTGTGAGACTTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-475s1c1
Sequence:CCGGCCAGAAATAAACACCAAGGAACTCGAGTTCCTTGGTGTTTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-863s1c1
Sequence:CCGGCTGCACTATTCACAGCGGATTCTCGAGAATCCGCTGTGAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-397s1c1
Sequence:CCGGCGCTTCTGTTACCAGAACACTCTCGAGAGTGTTCTGGTAACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1710s1c1
Sequence:CCGGCAACCGAAACTCATACCTGATCTCGAGATCAGGTATGAGTTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_168302
ZKSCAN1 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1331s1c1
Sequence:CCGGCGGGAACAAAGTCTCACAGATCTCGAGATCTGTGAGACTTTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-475s1c1
Sequence:CCGGCCAGAAATAAACACCAAGGAACTCGAGTTCCTTGGTGTTTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-863s1c1
Sequence:CCGGCTGCACTATTCACAGCGGATTCTCGAGAATCCGCTGTGAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-397s1c1
Sequence:CCGGCGCTTCTGTTACCAGAACACTCTCGAGAGTGTTCTGGTAACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_168302.4-1710s1c1
Sequence:CCGGCAACCGAAACTCATACCTGATCTCGAGATCAGGTATGAGTTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks