EMAIL THIS PAGE TO A FRIEND

ZKSCAN2

zinc finger with KRAB and SCAN domains 2

Synonyms: ZNF694 ZSCAN31 ZSCAN34
UniProtKB ID: Q63HK3, A1L3B4, Q6ZN77
Gene ID:
Mouse(210162) zinc finger with KRAB and SCAN domains 2
Rat(368120) zinc finger with KRAB and SCAN domains 2
cow(539463) zinc finger with KRAB and SCAN domains 2
sheep(101108275) zinc finger with KRAB and SCAN domains 2
domestic guinea pig(100720196) zinc finger with KRAB and SCAN domains 2
naked mole-rat(101701043) zinc finger with KRAB and SCAN domains 2
Domestic Rabbit(100357828) zinc finger with KRAB and SCAN domains 2
dog(489962) zinc finger with KRAB and SCAN domains 2
domestic cat(101096778) zinc finger with KRAB and SCAN domains 2
Horse(100061671) zinc finger with KRAB and SCAN domains 2
271 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049141 Anti-ZKSCAN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012981 Rosetta Predictions human pricing
XM_001079250 Rosetta Predictions rat pricing
XM_001079648 Rosetta Predictions rat pricing
NM_001081329 Rosetta Predictions mouse pricing
XM_622104 Rosetta Predictions mouse pricing
XM_894621 Rosetta Predictions mouse pricing
XM_901718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080485 predicted 2141
2 SASI_Hs01_00080486 predicted 2417
3 SASI_Hs01_00080487 predicted 2038
4 SASI_Hs01_00080488 predicted 533
5 SASI_Hs01_00080489 predicted 1960
6 SASI_Hs01_00080492 predicted 1622
7 SASI_Hs01_00080493 predicted 3264
8 SASI_Hs02_00306282 predicted 3061
9 SASI_Hs01_00080494 predicted 2656
10 SASI_Hs02_00306283 predicted 1296
11 SASI_Hs01_00080490 predicted 1542
12 SASI_Hs01_00080491 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363677 predicted 1391
2 SASI_Rn02_00363678 predicted 1864
3 SASI_Rn02_00363679 predicted 702
4 SASI_Rn02_00363680 predicted 1539
5 SASI_Rn02_00363681 predicted 692
6 SASI_Rn02_00363682 predicted 2195
7 SASI_Rn02_00363683 predicted 1526
8 SASI_Rn02_00363684 predicted 1228
9 SASI_Rn02_00363685 predicted 2222
10 SASI_Rn02_00363686 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364975 predicted 1861
2 SASI_Rn02_00364976 predicted 2958
3 SASI_Rn02_00364977 predicted 2526
4 SASI_Rn02_00364978 predicted 2202
5 SASI_Rn02_00364979 predicted 1519
6 SASI_Rn02_00364980 predicted 2872
7 SASI_Rn02_00364981 predicted 2423
8 SASI_Rn02_00364982 predicted 1936
9 SASI_Rn02_00364983 predicted 2813
10 SASI_Rn02_00364984 predicted 2681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297351 predicted 2341
2 SASI_Mm02_00297352 predicted 1048
3 SASI_Mm02_00297353 predicted 1187
4 SASI_Mm02_00297354 predicted 2015
5 SASI_Mm02_00297355 predicted 2691
6 SASI_Mm02_00297356 predicted 2071
7 SASI_Mm02_00297357 predicted 2202
8 SASI_Mm02_00297358 predicted 2629
9 SASI_Mm02_00297359 predicted 1606
10 SASI_Mm02_00297360 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224623 predicted 1344
2 SASI_Mm01_00224624 predicted 1178
3 SASI_Mm01_00224625 predicted 1323
4 SASI_Mm01_00224626 predicted 846
5 SASI_Mm01_00224627 predicted 1272
6 SASI_Mm01_00224628 predicted 711
7 SASI_Mm01_00224629 predicted 607
8 SASI_Mm01_00224630 predicted 1335
9 SASI_Mm01_00224631 predicted 1320
10 SASI_Mm01_00224632 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283056 predicted 3470
2 SASI_Mm01_00283057 predicted 3625
3 SASI_Mm01_00283058 predicted 2870
4 SASI_Mm01_00283059 predicted 3246
5 SASI_Mm01_00283060 predicted 3466
6 SASI_Mm01_00283061 predicted 3602
7 SASI_Mm01_00283062 predicted 2703
8 SASI_Mm01_00283063 predicted 3489
9 SASI_Mm01_00283064 predicted 3552
10 SASI_Mm01_00283065 predicted 2995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244942 predicted 1223
2 SASI_Mm01_00244943 predicted 1537
3 SASI_Mm01_00244944 predicted 1310
4 SASI_Mm01_00244945 predicted 1225
5 SASI_Mm01_00244946 predicted 691
6 SASI_Mm01_00244947 predicted 1320
7 SASI_Mm01_00244948 predicted 775
8 SASI_Mm01_00244949 predicted 814
9 SASI_Mm01_00244950 predicted 761
10 SASI_Mm01_00244951 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175435
ZKSCAN2 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175435.2-1875s1c1
Sequence:CCGGGCTGTCTCATTAAGAGACAATCTCGAGATTGTCTCTTAATGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-422s1c1
Sequence:CCGGGAGACCATATAGACTTCTCAACTCGAGTTGAGAAGTCTATATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-424s1c1
Sequence:CCGGGACCATATAGACTTCTCAAATCTCGAGATTTGAGAAGTCTATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-905s1c1
Sequence:CCGGGCGAATCCACAATGGAGAGAACTCGAGTTCTCTCCATTGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-553s1c1
Sequence:CCGGGCCTTATCAGACACCAAAGAACTCGAGTTCTTTGGTGTCTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175435
ZKSCAN2 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175435.2-1875s1c1
Sequence:CCGGGCTGTCTCATTAAGAGACAATCTCGAGATTGTCTCTTAATGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-422s1c1
Sequence:CCGGGAGACCATATAGACTTCTCAACTCGAGTTGAGAAGTCTATATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-424s1c1
Sequence:CCGGGACCATATAGACTTCTCAAATCTCGAGATTTGAGAAGTCTATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-905s1c1
Sequence:CCGGGCGAATCCACAATGGAGAGAACTCGAGTTCTCTCCATTGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-553s1c1
Sequence:CCGGGCCTTATCAGACACCAAAGAACTCGAGTTCTTTGGTGTCTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175435
ZKSCAN2 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175435.2-1875s1c1
Sequence:CCGGGCTGTCTCATTAAGAGACAATCTCGAGATTGTCTCTTAATGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-422s1c1
Sequence:CCGGGAGACCATATAGACTTCTCAACTCGAGTTGAGAAGTCTATATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-424s1c1
Sequence:CCGGGACCATATAGACTTCTCAAATCTCGAGATTTGAGAAGTCTATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-905s1c1
Sequence:CCGGGCGAATCCACAATGGAGAGAACTCGAGTTCTCTCCATTGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175435.2-553s1c1
Sequence:CCGGGCCTTATCAGACACCAAAGAACTCGAGTTCTTTGGTGTCTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012981
ZKSCAN2 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-1299s1c1
Sequence:CCGGCGAAGCAACTACGTCAAGGAACTCGAGTTCCTTGACGTAGTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-527s1c1
Sequence:CCGGCCGCAAATGCTTCAGGCAATTCTCGAGAATTGCCTGAAGCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-3097s1c1
Sequence:CCGGGATTTCGAGAACATCGGAGAACTCGAGTTCTCCGATGTTCTCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-2115s1c1
Sequence:CCGGGCGTTCTACAAGGAGATGGATCTCGAGATCCATCTCCTTGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012981.2-4634s1c1
Sequence:CCGGCCCAGTAAACACTGAAGGAAACTCGAGTTTCCTTCAGTGTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012981.4-3590s21c1
Sequence:CCGGTTGCTAAGTTCGGCAACATTCCTCGAGGAATGTTGCCGAACTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1825s21c1
Sequence:CCGGATGAAATAGGCATCGAATTTACTCGAGTAAATTCGATGCCTATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1538s21c1
Sequence:CCGGGGCTGAATGGTTGCGAGAATGCTCGAGCATTCTCGCAACCATTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012981
ZKSCAN2 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-1299s1c1
Sequence:CCGGCGAAGCAACTACGTCAAGGAACTCGAGTTCCTTGACGTAGTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-527s1c1
Sequence:CCGGCCGCAAATGCTTCAGGCAATTCTCGAGAATTGCCTGAAGCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-3097s1c1
Sequence:CCGGGATTTCGAGAACATCGGAGAACTCGAGTTCTCCGATGTTCTCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-2115s1c1
Sequence:CCGGGCGTTCTACAAGGAGATGGATCTCGAGATCCATCTCCTTGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012981.2-4634s1c1
Sequence:CCGGCCCAGTAAACACTGAAGGAAACTCGAGTTTCCTTCAGTGTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012981.4-3590s21c1
Sequence:CCGGTTGCTAAGTTCGGCAACATTCCTCGAGGAATGTTGCCGAACTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1825s21c1
Sequence:CCGGATGAAATAGGCATCGAATTTACTCGAGTAAATTCGATGCCTATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1538s21c1
Sequence:CCGGGGCTGAATGGTTGCGAGAATGCTCGAGCATTCTCGCAACCATTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012981
ZKSCAN2 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-1299s1c1
Sequence:CCGGCGAAGCAACTACGTCAAGGAACTCGAGTTCCTTGACGTAGTTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-527s1c1
Sequence:CCGGCCGCAAATGCTTCAGGCAATTCTCGAGAATTGCCTGAAGCATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-3097s1c1
Sequence:CCGGGATTTCGAGAACATCGGAGAACTCGAGTTCTCCGATGTTCTCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012981.2-2115s1c1
Sequence:CCGGGCGTTCTACAAGGAGATGGATCTCGAGATCCATCTCCTTGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012981.2-4634s1c1
Sequence:CCGGCCCAGTAAACACTGAAGGAAACTCGAGTTTCCTTCAGTGTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012981.4-3590s21c1
Sequence:CCGGTTGCTAAGTTCGGCAACATTCCTCGAGGAATGTTGCCGAACTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1825s21c1
Sequence:CCGGATGAAATAGGCATCGAATTTACTCGAGTAAATTCGATGCCTATTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012981.4-1538s21c1
Sequence:CCGGGGCTGAATGGTTGCGAGAATGCTCGAGCATTCTCGCAACCATTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081329
ZKSCAN2 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000415317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3425s21c1
Sequence:CCGGAGCAGTCTTCTTAGCTATAAACTCGAGTTTATAGCTAAGAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3462s21c1
Sequence:CCGGAGGCCTGAGAATCGAAGTAAACTCGAGTTTACTTCGATTCTCAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-1785s21c1
Sequence:CCGGGTGATCTCTCTCCCACTAAAGCTCGAGCTTTAGTGGGAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-602s21c1
Sequence:CCGGATGTGAGTCCTTCCGTAAATGCTCGAGCATTTACGGAAGGACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081329
ZKSCAN2 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000415317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3425s21c1
Sequence:CCGGAGCAGTCTTCTTAGCTATAAACTCGAGTTTATAGCTAAGAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3462s21c1
Sequence:CCGGAGGCCTGAGAATCGAAGTAAACTCGAGTTTACTTCGATTCTCAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-1785s21c1
Sequence:CCGGGTGATCTCTCTCCCACTAAAGCTCGAGCTTTAGTGGGAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-602s21c1
Sequence:CCGGATGTGAGTCCTTCCGTAAATGCTCGAGCATTTACGGAAGGACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081329
ZKSCAN2 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000415317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3425s21c1
Sequence:CCGGAGCAGTCTTCTTAGCTATAAACTCGAGTTTATAGCTAAGAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081329.1-3462s21c1
Sequence:CCGGAGGCCTGAGAATCGAAGTAAACTCGAGTTTACTTCGATTCTCAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-1785s21c1
Sequence:CCGGGTGATCTCTCTCCCACTAAAGCTCGAGCTTTAGTGGGAGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081329.1-602s21c1
Sequence:CCGGATGTGAGTCCTTCCGTAAATGCTCGAGCATTTACGGAAGGACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks