EMAIL THIS PAGE TO A FRIEND

ZKSCAN3

zinc finger with KRAB and SCAN domains 3

Synonyms: ZF47 ZFP306 ZNF306 ZNF309 ZSCAN13 ZSCAN35 Zfp47 dJ874C20.1 dJ874C20.1. zfp-47
Gene ID:
Mouse(72739) zinc finger with KRAB and SCAN domains 3
Rat(306977) zinc finger with KRAB and SCAN domains 3
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187011 MISSION® esiRNA esiRNA targeting mouse Zkscan3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024493 Rosetta Predictions human pricing
NM_001012053 Rosetta Predictions rat pricing
XM_574037 Rosetta Predictions rat pricing
NM_023685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356760 predicted 818
2 SASI_Hs01_00101703 predicted 688
3 SASI_Hs01_00101704 predicted 704
4 SASI_Hs01_00101706 predicted 1040
5 SASI_Hs02_00356761 predicted 796
6 SASI_Hs01_00101705 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200159 predicted 1092
2 SASI_Rn01_00091151 predicted 1397
3 SASI_Rn01_00091152 predicted 1050
4 SASI_Rn01_00091153 predicted 1052
5 SASI_Rn01_00091154 predicted 1549
6 SASI_Rn02_00200160 predicted 1634
7 SASI_Rn01_00091155 predicted 1521
8 SASI_Rn01_00091156 predicted 778
9 SASI_Rn01_00091157 predicted 1602
10 SASI_Rn01_00091158 predicted 533
11 SASI_Rn01_00091159 predicted 1631
12 SASI_Rn01_00091160 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160339 predicted 824
2 SASI_Rn01_00160340 predicted 827
3 SASI_Rn01_00160341 predicted 1003
4 SASI_Rn01_00160342 predicted 824
5 SASI_Rn01_00160343 predicted 912
6 SASI_Rn01_00160344 predicted 1088
7 SASI_Rn01_00160345 predicted 917
8 SASI_Rn01_00160346 predicted 860
9 SASI_Rn01_00160347 predicted 808
10 SASI_Rn01_00160348 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110101 predicted 1059
2 SASI_Mm01_00110102 predicted 562
3 SASI_Mm01_00110103 predicted 1069
4 SASI_Mm01_00110104 predicted 1559
5 SASI_Mm01_00110105 predicted 1612
6 SASI_Mm01_00110106 predicted 788
7 SASI_Mm01_00110107 predicted 788
8 SASI_Mm01_00110108 predicted 858
9 SASI_Mm01_00110109 predicted 678
10 SASI_Mm01_00110110 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024493
ZKSCAN3 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024493.2-694s21c1
Sequence:CCGGAGTAGCCAATTTCAGCTAATGCTCGAGCATTAGCTGAAATTGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1962s21c1
Sequence:CCGGTGTAGACTGGGTTAGACAAATCTCGAGATTTGTCTAACCCAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1604s1c1
Sequence:CCGGGAAAGAAGTTTCACTCAGAATCTCGAGATTCTGAGTGAAACTTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-215s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAGGAACTCGAGTTCCTCCACCTTTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1095s1c1
Sequence:CCGGGCCATGAATGTGGAAAGAGTTCTCGAGAACTCTTTCCACATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-205s1c1
Sequence:CCGGGATGGAGCTTCTGGTCATAAACTCGAGTTTATGACCAGAAGCTCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1383s1c1
Sequence:CCGGGCCTCCTTGAACATCACAGAACTCGAGTTCTGTGATGTTCAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1848s21c1
Sequence:CCGGGCCAGAGTTGGTGCTCATTTGCTCGAGCAAATGAGCACCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024493
ZKSCAN3 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024493.2-694s21c1
Sequence:CCGGAGTAGCCAATTTCAGCTAATGCTCGAGCATTAGCTGAAATTGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1962s21c1
Sequence:CCGGTGTAGACTGGGTTAGACAAATCTCGAGATTTGTCTAACCCAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1604s1c1
Sequence:CCGGGAAAGAAGTTTCACTCAGAATCTCGAGATTCTGAGTGAAACTTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-215s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAGGAACTCGAGTTCCTCCACCTTTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1095s1c1
Sequence:CCGGGCCATGAATGTGGAAAGAGTTCTCGAGAACTCTTTCCACATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-205s1c1
Sequence:CCGGGATGGAGCTTCTGGTCATAAACTCGAGTTTATGACCAGAAGCTCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1383s1c1
Sequence:CCGGGCCTCCTTGAACATCACAGAACTCGAGTTCTGTGATGTTCAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1848s21c1
Sequence:CCGGGCCAGAGTTGGTGCTCATTTGCTCGAGCAAATGAGCACCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024493
ZKSCAN3 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024493.2-694s21c1
Sequence:CCGGAGTAGCCAATTTCAGCTAATGCTCGAGCATTAGCTGAAATTGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1962s21c1
Sequence:CCGGTGTAGACTGGGTTAGACAAATCTCGAGATTTGTCTAACCCAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1604s1c1
Sequence:CCGGGAAAGAAGTTTCACTCAGAATCTCGAGATTCTGAGTGAAACTTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-215s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAGGAACTCGAGTTCCTCCACCTTTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1095s1c1
Sequence:CCGGGCCATGAATGTGGAAAGAGTTCTCGAGAACTCTTTCCACATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-205s1c1
Sequence:CCGGGATGGAGCTTCTGGTCATAAACTCGAGTTTATGACCAGAAGCTCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024493.1-1383s1c1
Sequence:CCGGGCCTCCTTGAACATCACAGAACTCGAGTTCTGTGATGTTCAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024493.2-1848s21c1
Sequence:CCGGGCCAGAGTTGGTGCTCATTTGCTCGAGCAAATGAGCACCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023685
VALIDATED
ZKSCAN3 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1568s21c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1075s21c1
Sequence:CCGGGCGGTTCTATTGCCGTGAATGCTCGAGCATTCACGGCAATAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-749s21c1
Sequence:CCGGACTAGGCTCACATCGGAATTACTCGAGTAATTCCGATGTGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1112s21c1
Sequence:CCGGCAGAGTTCAGGCCTAAGTAAACTCGAGTTTACTTAGGCCTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023685.4-2142s21c1
Sequence:CCGGCCTTGTATACAGGTGCTAATACTCGAGTATTAGCACCTGTATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1926s1c1
Sequence:CCGGCCTCACCCATTGGAACTAAATCTCGAGATTTAGTTCCAATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-784s1c1
Sequence:CCGGGCAGGATTCATCTCAGATGAACTCGAGTTCATCTGAGATGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-1652s1c1
Sequence:CCGGCGACCTTCATACCTTATTCAACTCGAGTTGAATAAGGTATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-167s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAACAACTCGAGTTGTTCCACCTTTATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1526s1c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023685
VALIDATED
ZKSCAN3 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1568s21c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1075s21c1
Sequence:CCGGGCGGTTCTATTGCCGTGAATGCTCGAGCATTCACGGCAATAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-749s21c1
Sequence:CCGGACTAGGCTCACATCGGAATTACTCGAGTAATTCCGATGTGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1112s21c1
Sequence:CCGGCAGAGTTCAGGCCTAAGTAAACTCGAGTTTACTTAGGCCTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023685.4-2142s21c1
Sequence:CCGGCCTTGTATACAGGTGCTAATACTCGAGTATTAGCACCTGTATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1926s1c1
Sequence:CCGGCCTCACCCATTGGAACTAAATCTCGAGATTTAGTTCCAATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-784s1c1
Sequence:CCGGGCAGGATTCATCTCAGATGAACTCGAGTTCATCTGAGATGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-1652s1c1
Sequence:CCGGCGACCTTCATACCTTATTCAACTCGAGTTGAATAAGGTATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-167s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAACAACTCGAGTTGTTCCACCTTTATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1526s1c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023685
VALIDATED
ZKSCAN3 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1568s21c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1075s21c1
Sequence:CCGGGCGGTTCTATTGCCGTGAATGCTCGAGCATTCACGGCAATAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-749s21c1
Sequence:CCGGACTAGGCTCACATCGGAATTACTCGAGTAATTCCGATGTGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023685.4-1112s21c1
Sequence:CCGGCAGAGTTCAGGCCTAAGTAAACTCGAGTTTACTTAGGCCTGAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023685.4-2142s21c1
Sequence:CCGGCCTTGTATACAGGTGCTAATACTCGAGTATTAGCACCTGTATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1926s1c1
Sequence:CCGGCCTCACCCATTGGAACTAAATCTCGAGATTTAGTTCCAATGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-784s1c1
Sequence:CCGGGCAGGATTCATCTCAGATGAACTCGAGTTCATCTGAGATGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-1652s1c1
Sequence:CCGGCGACCTTCATACCTTATTCAACTCGAGTTGAATAAGGTATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023685.2-167s1c1
Sequence:CCGGCTGGTCATAAAGGTGGAACAACTCGAGTTGTTCCACCTTTATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023685.2-1526s1c1
Sequence:CCGGCCTGTGTCTTATCAATGTAATCTCGAGATTACATTGATAAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks