EMAIL THIS PAGE TO A FRIEND

ZKSCAN4

zinc finger with KRAB and SCAN domains 4

Synonyms: P1P373C6 ZNF307 ZNF427 ZSCAN36 p373c6.1
UniProtKB ID: Q969J2, B2RE32, Q5U7L4
Gene ID:
Mouse(544922) zinc finger with KRAB and SCAN domains 4
Rat(291164) zinc finger with KRAB and SCAN domains 4
naked mole-rat(101721596) zinc finger with KRAB and SCAN domains 4
dog(100682684) zinc finger with KRAB and SCAN domains 4
Horse(100052339) zinc finger with KRAB and SCAN domains 4
Horse(100052276) zinc finger with KRAB and SCAN domains 4
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019110 Rosetta Predictions human pricing
XM_214482 Rosetta Predictions rat pricing
NM_001039115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083475 predicted 716
2 SASI_Hs01_00083476 predicted 752
3 SASI_Hs01_00083477 predicted 1198
4 SASI_Hs01_00083478 predicted 1740
5 SASI_Hs01_00083479 predicted 1559
6 SASI_Hs01_00083480 predicted 1941
7 SASI_Hs01_00083481 predicted 1298
8 SASI_Hs01_00083482 predicted 952
9 SASI_Hs01_00083483 predicted 1892
10 SASI_Hs01_00083484 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375345 predicted 1021
2 SASI_Rn02_00375346 predicted 868
3 SASI_Rn02_00375347 predicted 706
4 SASI_Rn02_00375348 predicted 891
5 SASI_Rn02_00375349 predicted 736
6 SASI_Rn02_00375350 predicted 725
7 SASI_Rn02_00375351 predicted 917
8 SASI_Rn02_00375352 predicted 680
9 SASI_Rn02_00375353 predicted 1026
10 SASI_Rn02_00375354 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048873 predicted 600
2 SASI_Mm01_00048874 predicted 1703
3 SASI_Mm01_00048875 predicted 689
4 SASI_Mm01_00048876 predicted 1720
5 SASI_Mm01_00048877 predicted 971
6 SASI_Mm01_00048879 predicted 688
7 SASI_Mm01_00048880 predicted 968
8 SASI_Mm01_00048881 predicted 1535
9 SASI_Mm01_00048882 predicted 1724
10 SASI_Mm02_00289806 predicted 214
11 SASI_Mm01_00048878 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019110
ZKSCAN4 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1721s1c1
Sequence:CCGGGAGAGAAGTTTCACACGGAATCTCGAGATTCCGTGTGAAACTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-723s1c1
Sequence:CCGGCACAAACTCAAGGGTCTCAAACTCGAGTTTGAGACCCTTGAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-713s1c1
Sequence:CCGGGCACTATTGACACAAACTCAACTCGAGTTGAGTTTGTGTCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1196s1c1
Sequence:CCGGAGGCGACATTATTGCCATGAACTCGAGTTCATGGCAATAATGTCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1403s1c1
Sequence:CCGGCACAGCTCAAACCTTATCAAACTCGAGTTTGATAAGGTTTGAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019110.3-1687s21c1
Sequence:CCGGTGAGGCTCCCGTGTCTTATAACTCGAGTTATAAGACACGGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1897s21c1
Sequence:CCGGGCCAACATTGGTGCTCATTTGCTCGAGCAAATGAGCACCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1986s21c1
Sequence:CCGGACTATACATCATCGGGTATTACTCGAGTAATACCCGATGATGTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019110
ZKSCAN4 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1721s1c1
Sequence:CCGGGAGAGAAGTTTCACACGGAATCTCGAGATTCCGTGTGAAACTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-723s1c1
Sequence:CCGGCACAAACTCAAGGGTCTCAAACTCGAGTTTGAGACCCTTGAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-713s1c1
Sequence:CCGGGCACTATTGACACAAACTCAACTCGAGTTGAGTTTGTGTCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1196s1c1
Sequence:CCGGAGGCGACATTATTGCCATGAACTCGAGTTCATGGCAATAATGTCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1403s1c1
Sequence:CCGGCACAGCTCAAACCTTATCAAACTCGAGTTTGATAAGGTTTGAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019110.3-1687s21c1
Sequence:CCGGTGAGGCTCCCGTGTCTTATAACTCGAGTTATAAGACACGGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1897s21c1
Sequence:CCGGGCCAACATTGGTGCTCATTTGCTCGAGCAAATGAGCACCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1986s21c1
Sequence:CCGGACTATACATCATCGGGTATTACTCGAGTAATACCCGATGATGTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019110
ZKSCAN4 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1721s1c1
Sequence:CCGGGAGAGAAGTTTCACACGGAATCTCGAGATTCCGTGTGAAACTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-723s1c1
Sequence:CCGGCACAAACTCAAGGGTCTCAAACTCGAGTTTGAGACCCTTGAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-713s1c1
Sequence:CCGGGCACTATTGACACAAACTCAACTCGAGTTGAGTTTGTGTCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1196s1c1
Sequence:CCGGAGGCGACATTATTGCCATGAACTCGAGTTCATGGCAATAATGTCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019110.3-1403s1c1
Sequence:CCGGCACAGCTCAAACCTTATCAAACTCGAGTTTGATAAGGTTTGAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019110.3-1687s21c1
Sequence:CCGGTGAGGCTCCCGTGTCTTATAACTCGAGTTATAAGACACGGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1897s21c1
Sequence:CCGGGCCAACATTGGTGCTCATTTGCTCGAGCAAATGAGCACCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019110.3-1986s21c1
Sequence:CCGGACTATACATCATCGGGTATTACTCGAGTAATACCCGATGATGTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039115
ZKSCAN4 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039115.1-1984s21c1
Sequence:CCGGTGCGGTCTTAGCTACCCTATTCTCGAGAATAGGGTAGCTAAGACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1483s21c1
Sequence:CCGGAGAAGCCTTCTTGAACATAAACTCGAGTTTATGTTCAAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-660s21c1
Sequence:CCGGACCATCCCAGGACTCACAAAGCTCGAGCTTTGTGAGTCCTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1335s21c1
Sequence:CCGGTCAGCGGATCCATGGTGATAACTCGAGTTATCACCATGGATCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-715s21c1
Sequence:CCGGCACGAATCTCAGGAATCTTTGCTCGAGCAAAGATTCCTGAGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039115
ZKSCAN4 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039115.1-1984s21c1
Sequence:CCGGTGCGGTCTTAGCTACCCTATTCTCGAGAATAGGGTAGCTAAGACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1483s21c1
Sequence:CCGGAGAAGCCTTCTTGAACATAAACTCGAGTTTATGTTCAAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-660s21c1
Sequence:CCGGACCATCCCAGGACTCACAAAGCTCGAGCTTTGTGAGTCCTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1335s21c1
Sequence:CCGGTCAGCGGATCCATGGTGATAACTCGAGTTATCACCATGGATCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-715s21c1
Sequence:CCGGCACGAATCTCAGGAATCTTTGCTCGAGCAAAGATTCCTGAGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039115
ZKSCAN4 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039115.1-1984s21c1
Sequence:CCGGTGCGGTCTTAGCTACCCTATTCTCGAGAATAGGGTAGCTAAGACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1483s21c1
Sequence:CCGGAGAAGCCTTCTTGAACATAAACTCGAGTTTATGTTCAAGAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-660s21c1
Sequence:CCGGACCATCCCAGGACTCACAAAGCTCGAGCTTTGTGAGTCCTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-1335s21c1
Sequence:CCGGTCAGCGGATCCATGGTGATAACTCGAGTTATCACCATGGATCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039115.1-715s21c1
Sequence:CCGGCACGAATCTCAGGAATCTTTGCTCGAGCAAAGATTCCTGAGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks