EMAIL THIS PAGE TO A FRIEND

ZKSCAN5

zinc finger with KRAB and SCAN domains 5

Synonyms: ZFP95 ZNF914 ZSCAN37
UniProtKB ID: Q9Y2L8, A4D280, D6W5S9
Gene ID:
Human(23660) Summary: This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain. A similar protein in mouse is differentially expressed in spermatogenesis. Two alternatively spliced transcript variants differing only in the 5' UTR have been described. Additional variants have been found, but their full-length sequences have not been determined. [provided by RefSeq, Jul 2008]
Mouse(22757) zinc finger with KRAB and SCAN domains 5
Rat(304275) zinc finger with KRAB and SCAN domains 5
domestic cat(101086364) zinc finger with KRAB and SCAN domains 5
dog(489856) zinc finger with KRAB and SCAN domains 5
naked mole-rat(101701573) zinc finger with KRAB and SCAN domains 5
Domestic Rabbit(100345543) zinc finger with KRAB and SCAN domains 5
domestic guinea pig(100713285) zinc finger with KRAB and SCAN domains 5
cow(516885) zinc finger with KRAB and SCAN domains 5
sheep(101109324) zinc finger with KRAB and SCAN domains 5
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014569 Rosetta Predictions human pricing
NM_145102 Rosetta Predictions human pricing
NM_001107119 Rosetta Predictions rat pricing
NM_016683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096184 predicted 1044
2 SASI_Hs01_00096185 predicted 2663
3 SASI_Hs01_00096186 predicted 1832
4 SASI_Hs01_00096187 predicted 675
5 SASI_Hs02_00345834 predicted 1202
6 SASI_Hs01_00096188 predicted 2727
7 SASI_Hs01_00096190 predicted 1725
8 SASI_Hs01_00096191 predicted 2001
9 SASI_Hs01_00096192 predicted 1163
10 SASI_Hs02_00345835 predicted 2757
11 SASI_Hs01_00096189 predicted 2790
12 SASI_Hs01_00096193 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074673 predicted 914
2 SASI_Hs01_00074674 predicted 2539
3 SASI_Hs01_00074675 predicted 1706
4 SASI_Hs01_00074676 predicted 549
5 SASI_Hs02_00364973 predicted 1072
6 SASI_Hs01_00074677 predicted 2598
7 SASI_Hs01_00074679 predicted 1596
8 SASI_Hs01_00074680 predicted 1877
9 SASI_Hs01_00074681 predicted 1037
10 SASI_Hs02_00364974 predicted 2626
11 SASI_Hs01_00074678 predicted 2668
12 SASI_Hs01_00074682 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225686 predicted 2143
2 SASI_Rn02_00225687 predicted 2667
3 SASI_Rn02_00225688 predicted 2039
4 SASI_Rn02_00225689 predicted 3151
5 SASI_Rn02_00225690 predicted 1373
6 SASI_Rn02_00225691 predicted 2230
7 SASI_Rn02_00225692 predicted 1047
8 SASI_Rn02_00225693 predicted 3090
9 SASI_Rn02_00225694 predicted 1101
10 SASI_Rn02_00225695 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114613 predicted 1718
2 SASI_Mm02_00323334 predicted 2225
3 SASI_Mm01_00114615 predicted 742
4 SASI_Mm01_00114617 predicted 364
5 SASI_Mm02_00323335 predicted 2217
6 SASI_Mm01_00114618 predicted 481
7 SASI_Mm01_00114619 predicted 1628
8 SASI_Mm01_00114620 predicted 1619
9 SASI_Mm01_00114621 predicted 418
10 SASI_Mm01_00114622 predicted 749
11 SASI_Mm01_00114614 predicted 1437
12 SASI_Mm01_00114616 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016683
ZKSCAN5 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-127s21c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2132s21c1
Sequence:CCGGGGAACCTGACGGTGATCAAAGCTCGAGCTTTGATCACCGTCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016683.1-2688s21c1
Sequence:CCGGGGTGCTCCGATAGCATCTTTACTCGAGTAAAGATGCTATCGGAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2501s21c1
Sequence:CCGGACGAGAGGACAGATCCATAAGCTCGAGCTTATGGATCTGTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-739s21c1
Sequence:CCGGCTGGAGGAATGGGCACATTTGCTCGAGCAAATGTGCCCATTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016683
ZKSCAN5 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-127s21c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2132s21c1
Sequence:CCGGGGAACCTGACGGTGATCAAAGCTCGAGCTTTGATCACCGTCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016683.1-2688s21c1
Sequence:CCGGGGTGCTCCGATAGCATCTTTACTCGAGTAAAGATGCTATCGGAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2501s21c1
Sequence:CCGGACGAGAGGACAGATCCATAAGCTCGAGCTTATGGATCTGTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-739s21c1
Sequence:CCGGCTGGAGGAATGGGCACATTTGCTCGAGCAAATGTGCCCATTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016683
ZKSCAN5 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-127s21c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2132s21c1
Sequence:CCGGGGAACCTGACGGTGATCAAAGCTCGAGCTTTGATCACCGTCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016683.1-2688s21c1
Sequence:CCGGGGTGCTCCGATAGCATCTTTACTCGAGTAAAGATGCTATCGGAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-2501s21c1
Sequence:CCGGACGAGAGGACAGATCCATAAGCTCGAGCTTATGGATCTGTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016683.1-739s21c1
Sequence:CCGGCTGGAGGAATGGGCACATTTGCTCGAGCAAATGTGCCCATTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014569
VALIDATED
ZKSCAN5 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2228s21c1
Sequence:CCGGATCCCATCAGTGTCGTGAATGCTCGAGCATTCACGACACTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2263s21c1
Sequence:CCGGTTCAGTACGTTAGCCTAATTGCTCGAGCAATTAGGCTAACGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2721s21c1
Sequence:CCGGGAGAGGACAGATCCCATAAATCTCGAGATTTATGGGATCTGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2765s21c1
Sequence:CCGGGTTGTAGAATAGCTCTTAATTCTCGAGAATTAAGAGCTATTCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-2493s1c1
Sequence:CCGGCCCACACCAAACAACATCAAACTCGAGTTTGATGTTGTTTGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-2652s1c1
Sequence:CCGGGCTGGAGTTGTAGCCTCTTTACTCGAGTAAAGAGGCTACAACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1548s1c1
Sequence:CCGGCGCATCTGATCGAACACCTAACTCGAGTTAGGTGTTCGATCAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-1747s1c1
Sequence:CCGGGCTGGATAGAAAGCAGGGAATCTCGAGATTCCCTGCTTTCTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1292s1c1
Sequence:CCGGGCCTCAAACTTTATTCAGCATCTCGAGATGCTGAATAAAGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014569
VALIDATED
ZKSCAN5 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2228s21c1
Sequence:CCGGATCCCATCAGTGTCGTGAATGCTCGAGCATTCACGACACTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2263s21c1
Sequence:CCGGTTCAGTACGTTAGCCTAATTGCTCGAGCAATTAGGCTAACGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2721s21c1
Sequence:CCGGGAGAGGACAGATCCCATAAATCTCGAGATTTATGGGATCTGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2765s21c1
Sequence:CCGGGTTGTAGAATAGCTCTTAATTCTCGAGAATTAAGAGCTATTCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-2493s1c1
Sequence:CCGGCCCACACCAAACAACATCAAACTCGAGTTTGATGTTGTTTGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-2652s1c1
Sequence:CCGGGCTGGAGTTGTAGCCTCTTTACTCGAGTAAAGAGGCTACAACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1548s1c1
Sequence:CCGGCGCATCTGATCGAACACCTAACTCGAGTTAGGTGTTCGATCAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-1747s1c1
Sequence:CCGGGCTGGATAGAAAGCAGGGAATCTCGAGATTCCCTGCTTTCTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1292s1c1
Sequence:CCGGGCCTCAAACTTTATTCAGCATCTCGAGATGCTGAATAAAGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014569
VALIDATED
ZKSCAN5 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2228s21c1
Sequence:CCGGATCCCATCAGTGTCGTGAATGCTCGAGCATTCACGACACTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2263s21c1
Sequence:CCGGTTCAGTACGTTAGCCTAATTGCTCGAGCAATTAGGCTAACGTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2721s21c1
Sequence:CCGGGAGAGGACAGATCCCATAAATCTCGAGATTTATGGGATCTGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014569.3-2765s21c1
Sequence:CCGGGTTGTAGAATAGCTCTTAATTCTCGAGAATTAAGAGCTATTCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-2493s1c1
Sequence:CCGGCCCACACCAAACAACATCAAACTCGAGTTTGATGTTGTTTGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-2652s1c1
Sequence:CCGGGCTGGAGTTGTAGCCTCTTTACTCGAGTAAAGAGGCTACAACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1548s1c1
Sequence:CCGGCGCATCTGATCGAACACCTAACTCGAGTTAGGTGTTCGATCAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014569.2-1747s1c1
Sequence:CCGGGCTGGATAGAAAGCAGGGAATCTCGAGATTCCCTGCTTTCTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014569.2-1292s1c1
Sequence:CCGGGCCTCAAACTTTATTCAGCATCTCGAGATGCTGAATAAAGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355663
VALIDATED
ZKSCAN5 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-2933s1c1
Sequence:CCGGGCAGTAGACATAAGCTCATTTCTCGAGAAATGAGCTTATGTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-119s1c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-122s1c1
Sequence:CCGGGACCTTCTCATAGTGAAAGTACTCGAGTACTTTCACTATGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355663.1-1841s1c1
Sequence:CCGGGCCTGTCACTTATGTGGGAAACTCGAGTTTCCCACATAAGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-1419s1c1
Sequence:CCGGGCGACAGAAGAAGTAAGAACACTCGAGTGTTCTTACTTCTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355663
VALIDATED
ZKSCAN5 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-2933s1c1
Sequence:CCGGGCAGTAGACATAAGCTCATTTCTCGAGAAATGAGCTTATGTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-119s1c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-122s1c1
Sequence:CCGGGACCTTCTCATAGTGAAAGTACTCGAGTACTTTCACTATGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355663.1-1841s1c1
Sequence:CCGGGCCTGTCACTTATGTGGGAAACTCGAGTTTCCCACATAAGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-1419s1c1
Sequence:CCGGGCGACAGAAGAAGTAAGAACACTCGAGTGTTCTTACTTCTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355663
VALIDATED
ZKSCAN5 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-2933s1c1
Sequence:CCGGGCAGTAGACATAAGCTCATTTCTCGAGAAATGAGCTTATGTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-119s1c1
Sequence:CCGGGCAGACCTTCTCATAGTGAAACTCGAGTTTCACTATGAGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-122s1c1
Sequence:CCGGGACCTTCTCATAGTGAAAGTACTCGAGTACTTTCACTATGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355663.1-1841s1c1
Sequence:CCGGGCCTGTCACTTATGTGGGAAACTCGAGTTTCCCACATAAGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355663.1-1419s1c1
Sequence:CCGGGCGACAGAAGAAGTAAGAACACTCGAGTGTTCTTACTTCTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks