EMAIL THIS PAGE TO A FRIEND

ZKSCAN7

zinc finger with KRAB and SCAN domains 7

Synonyms: ZFP ZNF167 ZNF448 ZNF64 ZSCAN39
UniProtKB ID: Q9P0L1, A0PJV3, A8K5H0, Q6WL09, Q96FQ2
Gene ID:
Mouse(382118) zinc finger with KRAB and SCAN domains 7
cow(101905790) zinc finger with KRAB and SCAN domains 7
domestic guinea pig(101787374) zinc finger with KRAB and SCAN domains 7
naked mole-rat(101723275) zinc finger with KRAB and SCAN domains 7
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001474510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001474510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001474510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018651 Rosetta Predictions human pricing
NM_025169 Rosetta Predictions human pricing
XM_001474510 Rosetta Predictions mouse pricing
XM_888397 Rosetta Predictions mouse pricing
XM_988711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232062 predicted 544
2 SASI_Hs01_00232063 predicted 804
3 SASI_Hs01_00232064 predicted 871
4 SASI_Hs01_00232065 predicted 569
5 SASI_Hs01_00232066 predicted 585
6 SASI_Hs01_00232069 predicted 821
7 SASI_Hs02_00352152 predicted 559
8 SASI_Hs01_00232070 predicted 623
9 SASI_Hs01_00232071 predicted 583
10 SASI_Hs02_00352153 predicted 877
11 SASI_Hs01_00232067 predicted 1005
12 SASI_Hs01_00232068 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219298 predicted 545
2 SASI_Hs01_00219299 predicted 809
3 SASI_Hs01_00219300 predicted 869
4 SASI_Hs01_00219301 predicted 576
5 SASI_Hs01_00219302 predicted 587
6 SASI_Hs01_00219305 predicted 815
7 SASI_Hs02_00357922 predicted 561
8 SASI_Hs01_00219306 predicted 625
9 SASI_Hs01_00219307 predicted 588
10 SASI_Hs02_00357923 predicted 879
11 SASI_Hs01_00219303 predicted 1003
12 SASI_Hs01_00219304 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00375897 predicted 1979
2 SASI_Mm02_00375898 predicted 1969
3 SASI_Mm02_00375899 predicted 1024
4 SASI_Mm02_00375900 predicted 809
5 SASI_Mm02_00375901 predicted 706
6 SASI_Mm02_00375902 predicted 1223
7 SASI_Mm02_00375903 predicted 821
8 SASI_Mm02_00375904 predicted 1649
9 SASI_Mm02_00375905 predicted 1797
10 SASI_Mm02_00375906 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223301 predicted 405
2 SASI_Mm01_00223302 predicted 381
3 SASI_Mm01_00223303 predicted 404
4 SASI_Mm01_00223304 predicted 431
5 SASI_Mm01_00223305 predicted 431
6 SASI_Mm01_00223306 predicted 376
7 SASI_Mm01_00223307 predicted 467
8 SASI_Mm01_00223308 predicted 322
9 SASI_Mm01_00223309 predicted 381
10 SASI_Mm01_00223310 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449726 predicted 1978
2 SASI_Mm02_00449727 predicted 1969
3 SASI_Mm02_00449728 predicted 1022
4 SASI_Mm02_00449729 predicted 2042
5 SASI_Mm02_00449730 predicted 224
6 SASI_Mm02_00449731 predicted 707
7 SASI_Mm02_00449732 predicted 1220
8 SASI_Mm02_00449733 predicted 1641
9 SASI_Mm02_00449734 predicted 1797
10 SASI_Mm02_00449735 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001474510
ZKSCAN7 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-1338s21c1
Sequence:CCGGCAACACCAGAGACTCCGTAATCTCGAGATTACGGAGTCTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474510.1-2260s21c1
Sequence:CCGGCTGAGTTAATTTGTTTAGAAGCTCGAGCTTCTAAACAAATTAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-918s21c1
Sequence:CCGGGACATCTGTAAAGATCCTTTACTCGAGTAAAGGATCTTTACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2146s21c1
Sequence:CCGGTTAGTCAGCGGTCCACCTTTACTCGAGTAAAGGTGGACCGCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2208s21c1
Sequence:CCGGCGGCTTCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001474510
ZKSCAN7 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-1338s21c1
Sequence:CCGGCAACACCAGAGACTCCGTAATCTCGAGATTACGGAGTCTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474510.1-2260s21c1
Sequence:CCGGCTGAGTTAATTTGTTTAGAAGCTCGAGCTTCTAAACAAATTAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-918s21c1
Sequence:CCGGGACATCTGTAAAGATCCTTTACTCGAGTAAAGGATCTTTACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2146s21c1
Sequence:CCGGTTAGTCAGCGGTCCACCTTTACTCGAGTAAAGGTGGACCGCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2208s21c1
Sequence:CCGGCGGCTTCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001474510
ZKSCAN7 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-1338s21c1
Sequence:CCGGCAACACCAGAGACTCCGTAATCTCGAGATTACGGAGTCTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474510.1-2260s21c1
Sequence:CCGGCTGAGTTAATTTGTTTAGAAGCTCGAGCTTCTAAACAAATTAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-918s21c1
Sequence:CCGGGACATCTGTAAAGATCCTTTACTCGAGTAAAGGATCTTTACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2146s21c1
Sequence:CCGGTTAGTCAGCGGTCCACCTTTACTCGAGTAAAGGTGGACCGCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474510.1-2208s21c1
Sequence:CCGGCGGCTTCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025169
ZKSCAN7 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-566s1c1
Sequence:CCGGCGAAATCTTCCGGCTACACTTCTCGAGAAGTGTAGCCGGAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-590s1c1
Sequence:CCGGGCAATTGTGTTACCACGAGATCTCGAGATCTCGTGGTAACACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-1110s1c1
Sequence:CCGGGCATATGAGGACCTATCTGTACTCGAGTACAGATAGGTCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-889s1c1
Sequence:CCGGCTCTGGGTACAACAAAGGAATCTCGAGATTCCTTTGTTGTACCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025169.1-1542s1c1
Sequence:CCGGCCCGAGTTCTACGTCCCACATCTCGAGATGTGGGACGTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025169
ZKSCAN7 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-566s1c1
Sequence:CCGGCGAAATCTTCCGGCTACACTTCTCGAGAAGTGTAGCCGGAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-590s1c1
Sequence:CCGGGCAATTGTGTTACCACGAGATCTCGAGATCTCGTGGTAACACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-1110s1c1
Sequence:CCGGGCATATGAGGACCTATCTGTACTCGAGTACAGATAGGTCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-889s1c1
Sequence:CCGGCTCTGGGTACAACAAAGGAATCTCGAGATTCCTTTGTTGTACCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025169.1-1542s1c1
Sequence:CCGGCCCGAGTTCTACGTCCCACATCTCGAGATGTGGGACGTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025169
ZKSCAN7 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-566s1c1
Sequence:CCGGCGAAATCTTCCGGCTACACTTCTCGAGAAGTGTAGCCGGAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-590s1c1
Sequence:CCGGGCAATTGTGTTACCACGAGATCTCGAGATCTCGTGGTAACACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-1110s1c1
Sequence:CCGGGCATATGAGGACCTATCTGTACTCGAGTACAGATAGGTCCTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025169.1-889s1c1
Sequence:CCGGCTCTGGGTACAACAAAGGAATCTCGAGATTCCTTTGTTGTACCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025169.1-1542s1c1
Sequence:CCGGCCCGAGTTCTACGTCCCACATCTCGAGATGTGGGACGTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks