EMAIL THIS PAGE TO A FRIEND

ZKSCAN8

zinc finger with KRAB and SCAN domains 8

Synonyms: LD5-1 ZNF192 ZSCAN40
Species: Human ZKSCAN8(7745), Mouse Zkscan8(93681), naked mole-rat Zkscan8(101715700), domestic guinea pig Zkscan8(100733005)
UniProtKB ID: Q15776, A1L3D4, Q4VAR1, Q4VAR2, Q4VAR3, Q9H4T1
Gene ID:
Mouse(93681) zinc finger with KRAB and SCAN domains 8
naked mole-rat(101715700) zinc finger with KRAB and SCAN domains 8
domestic guinea pig(100733005) zinc finger with KRAB and SCAN domains 8
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105366 Anti-ZFP192 antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse
western blot pricing
HPA003483 Anti-ZKSCAN8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102811 Anti-ZNF192 (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102812 Anti-ZNF192 (ab2) antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, canine, human, horse, rabbit, guinea pig
western blot pricing
SAB2102813 Anti-ZNF192 (ab3) antibody produced in rabbit affinity isolated antibody horse, human, rat, canine, pig, bovine, mouse, guinea pig, rabbit
western blot pricing
AV37750 Anti-ZNF192 antibody produced in rabbit affinity isolated antibody bovine, human, horse, canine
western blot pricing
SAB2104746 Anti-ZNF192, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse, rabbit
western blot pricing
SAB1404552 Monoclonal Anti-ZNF192, (N-terminal) antibody produced in mouse clone 3B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1402407 Monoclonal Anti-ZNF192, (N-terminal) antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006298 Rosetta Predictions human pricing
NM_139141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094448 predicted 1974
2 SASI_Hs01_00094449 predicted 1936
3 SASI_Hs02_00341307 predicted 663
4 SASI_Hs01_00094450 predicted 971
5 SASI_Hs01_00094452 predicted 1912
6 SASI_Hs01_00094453 predicted 1924
7 SASI_Hs01_00094455 predicted 280
8 SASI_Hs01_00094457 predicted 1132
9 SASI_Hs02_00341308 predicted 1947
10 SASI_Hs02_00341309 predicted 547
11 SASI_Hs01_00094451 predicted 739
12 SASI_Hs01_00094454 predicted 687
13 SASI_Hs01_00094456 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047185 predicted 386
2 SASI_Mm01_00047186 predicted 1009
3 SASI_Mm02_00339880 predicted 2002
4 SASI_Mm01_00047188 predicted 2097
5 SASI_Mm01_00047190 predicted 1995
6 SASI_Mm01_00047191 predicted 1610
7 SASI_Mm01_00047192 predicted 1061
8 SASI_Mm01_00047193 predicted 1227
9 SASI_Mm02_00339881 predicted 1696
10 SASI_Mm01_00047194 predicted 2050
11 SASI_Mm01_00047187 predicted 1707
12 SASI_Mm01_00047189 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006298
ZKSCAN8 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006298.1-3264s1c1
Sequence:CCGGGCCAGAACTTACGCATCCAATCTCGAGATTGGATGCGTAAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-1275s1c1
Sequence:CCGGCCCTTCTTTCACATCAGGATACTCGAGTATCCTGATGTGAAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-428s1c1
Sequence:CCGGCCAGATTTGAACACCAAGGAACTCGAGTTCCTTGGTGTTCAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-555s1c1
Sequence:CCGGCCCTATTAGAGGATTTGGAAACTCGAGTTTCCAAATCCTCTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-886s1c1
Sequence:CCGGGCTTCTTGATCCATCACAGAACTCGAGTTCTGTGATGGATCAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-500s21c1
Sequence:CCGGGAGCTCCAGACACTGGTTAAGCTCGAGCTTAACCAGTGTCTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-568s21c1
Sequence:CCGGTTTGGAAAGGCAGATTGATATCTCGAGATATCAATCTGCCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006298.2-3174s21c1
Sequence:CCGGAGTATCACCAGGCACTATATTCTCGAGAATATAGTGCCTGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1133s21c1
Sequence:GTACCGGACACAAGAGAGACGACATAAACTCGAGTTTATGTCGTCTCTCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1900s21c1
Sequence:CCGGATCTGAATCCATAAGCGTTTACTCGAGTAAACGCTTATGGATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006298
ZKSCAN8 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006298.1-3264s1c1
Sequence:CCGGGCCAGAACTTACGCATCCAATCTCGAGATTGGATGCGTAAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-1275s1c1
Sequence:CCGGCCCTTCTTTCACATCAGGATACTCGAGTATCCTGATGTGAAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-428s1c1
Sequence:CCGGCCAGATTTGAACACCAAGGAACTCGAGTTCCTTGGTGTTCAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-555s1c1
Sequence:CCGGCCCTATTAGAGGATTTGGAAACTCGAGTTTCCAAATCCTCTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-886s1c1
Sequence:CCGGGCTTCTTGATCCATCACAGAACTCGAGTTCTGTGATGGATCAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-500s21c1
Sequence:CCGGGAGCTCCAGACACTGGTTAAGCTCGAGCTTAACCAGTGTCTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-568s21c1
Sequence:CCGGTTTGGAAAGGCAGATTGATATCTCGAGATATCAATCTGCCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006298.2-3174s21c1
Sequence:CCGGAGTATCACCAGGCACTATATTCTCGAGAATATAGTGCCTGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1133s21c1
Sequence:GTACCGGACACAAGAGAGACGACATAAACTCGAGTTTATGTCGTCTCTCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1900s21c1
Sequence:CCGGATCTGAATCCATAAGCGTTTACTCGAGTAAACGCTTATGGATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006298
ZKSCAN8 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006298.1-3264s1c1
Sequence:CCGGGCCAGAACTTACGCATCCAATCTCGAGATTGGATGCGTAAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-1275s1c1
Sequence:CCGGCCCTTCTTTCACATCAGGATACTCGAGTATCCTGATGTGAAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-428s1c1
Sequence:CCGGCCAGATTTGAACACCAAGGAACTCGAGTTCCTTGGTGTTCAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-555s1c1
Sequence:CCGGCCCTATTAGAGGATTTGGAAACTCGAGTTTCCAAATCCTCTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006298.1-886s1c1
Sequence:CCGGGCTTCTTGATCCATCACAGAACTCGAGTTCTGTGATGGATCAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-500s21c1
Sequence:CCGGGAGCTCCAGACACTGGTTAAGCTCGAGCTTAACCAGTGTCTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-568s21c1
Sequence:CCGGTTTGGAAAGGCAGATTGATATCTCGAGATATCAATCTGCCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006298.2-3174s21c1
Sequence:CCGGAGTATCACCAGGCACTATATTCTCGAGAATATAGTGCCTGGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1133s21c1
Sequence:GTACCGGACACAAGAGAGACGACATAAACTCGAGTTTATGTCGTCTCTCTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006298.2-1900s21c1
Sequence:CCGGATCTGAATCCATAAGCGTTTACTCGAGTAAACGCTTATGGATTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139141
ZKSCAN8 MISSION shRNA Bacterial Glycerol Stock
zinc finger with KRAB and SCAN domains 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139141.2-2038s1c1
Sequence:CCGGCATTAGAGAAACCATGTACTACTCGAGTAGTACATGGTTTCTCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-291s1c1
Sequence:CCGGCCTGAAGAGGATCTTGTCATTCTCGAGAATGACAAGATCCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-915s1c1
Sequence:CCGGCAGACTTTGGAAAGGATTGAACTCGAGTTCAATCCTTTCCAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-1225s1c1
Sequence:CCGGGACGACATAAATGTGATGAATCTCGAGATTCATCACATTTATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-726s1c1
Sequence:CCGGCCTCCAAGTATTCACGTACAACTCGAGTTGTACGTGAATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139141
ZKSCAN8 MISSION shRNA shRNA Plasmid DNA
zinc finger with KRAB and SCAN domains 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139141.2-2038s1c1
Sequence:CCGGCATTAGAGAAACCATGTACTACTCGAGTAGTACATGGTTTCTCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-291s1c1
Sequence:CCGGCCTGAAGAGGATCTTGTCATTCTCGAGAATGACAAGATCCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-915s1c1
Sequence:CCGGCAGACTTTGGAAAGGATTGAACTCGAGTTCAATCCTTTCCAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-1225s1c1
Sequence:CCGGGACGACATAAATGTGATGAATCTCGAGATTCATCACATTTATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-726s1c1
Sequence:CCGGCCTCCAAGTATTCACGTACAACTCGAGTTGTACGTGAATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139141
ZKSCAN8 MISSION shRNA Lentiviral Transduction Particles
zinc finger with KRAB and SCAN domains 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139141.2-2038s1c1
Sequence:CCGGCATTAGAGAAACCATGTACTACTCGAGTAGTACATGGTTTCTCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-291s1c1
Sequence:CCGGCCTGAAGAGGATCTTGTCATTCTCGAGAATGACAAGATCCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-915s1c1
Sequence:CCGGCAGACTTTGGAAAGGATTGAACTCGAGTTCAATCCTTTCCAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-1225s1c1
Sequence:CCGGGACGACATAAATGTGATGAATCTCGAGATTCATCACATTTATGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139141.2-726s1c1
Sequence:CCGGCCTCCAAGTATTCACGTACAACTCGAGTTGTACGTGAATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks