EMAIL THIS PAGE TO A FRIEND

ZMAT1

zinc finger, matrin-type 1

UniProtKB ID: Q5H9K5, Q8NDS3, Q96JN6
Gene ID:
Human(84460) Summary: This gene encodes a protein containing Cys2-His2 (C2H2)-type zinc fingers, which are similar to those found in the nuclear matrix protein matrin 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(215693) zinc finger, matrin type 1
Rat(308654) zinc finger, matrin-type 1
dog(480993) zinc finger, matrin-type 1
Horse(100067200) zinc finger, matrin-type 1
domestic cat(101093421) zinc finger, matrin-type 1
cow(504576) zinc finger, matrin-type 1
sheep(101121243) zinc finger, matrin-type 1
domestic guinea pig(100717562) zinc finger, matrin-type 1
naked mole-rat(101708910) zinc finger, matrin-type 1
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012827 Anti-ZMAT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV30058 Anti-ZMAT1 antibody produced in rabbit affinity isolated antibody human, horse, canine, mouse, guinea pig, rabbit, rat, pig, bovine
western blot pricing
SAB2105757 Anti-ZMAT1 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011656 Rosetta Predictions human pricing
NM_001011657 Rosetta Predictions human pricing
NM_032441 Rosetta Predictions human pricing
XM_218706 Rosetta Predictions rat pricing
XR_008618 Rosetta Predictions rat pricing
NM_175446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072885 predicted 1016
2 SASI_Hs01_00072886 predicted 904
3 SASI_Hs01_00072887 predicted 706
4 SASI_Hs01_00072888 predicted 1069
5 SASI_Hs01_00072889 predicted 529
6 SASI_Hs01_00072890 predicted 575
7 SASI_Hs01_00072891 predicted 578
8 SASI_Hs01_00072892 predicted 585
9 SASI_Hs01_00072893 predicted 527
10 SASI_Hs01_00072894 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010841 predicted 1435
2 SASI_Hs01_00010842 predicted 1838
3 SASI_Hs01_00010843 predicted 1118
4 SASI_Hs01_00010845 predicted 1603
5 SASI_Hs01_00010846 predicted 1726
6 SASI_Hs02_00306006 predicted 1842
7 SASI_Hs01_00010847 predicted 1555
8 SASI_Hs01_00010848 predicted 1233
9 SASI_Hs01_00010849 predicted 1656
10 SASI_Hs01_00010850 predicted 1048
11 SASI_Hs01_00010844 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134919 predicted 4107
2 SASI_Hs01_00134920 predicted 4513
3 SASI_Hs01_00134921 predicted 3794
4 SASI_Hs01_00134923 predicted 4272
5 SASI_Hs01_00134924 predicted 4402
6 SASI_Hs02_00359854 predicted 4512
7 SASI_Hs01_00134925 predicted 4234
8 SASI_Hs01_00134926 predicted 3905
9 SASI_Hs01_00134927 predicted 4328
10 SASI_Hs01_00134928 predicted 3722
11 SASI_Hs01_00134922 predicted 4354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158993 predicted 1459
2 SASI_Rn01_00158994 predicted 1620
3 SASI_Rn01_00158995 predicted 1488
4 SASI_Rn01_00158996 predicted 1303
5 SASI_Rn01_00158997 predicted 1566
6 SASI_Rn01_00158998 predicted 1512
7 SASI_Rn01_00158999 predicted 1189
8 SASI_Rn01_00159000 predicted 1388
9 SASI_Rn01_00159001 predicted 1702
10 SASI_Rn01_00159002 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135066 predicted 1040
2 SASI_Rn01_00135067 predicted 580
3 SASI_Rn01_00135068 predicted 1307
4 SASI_Rn01_00135069 predicted 999
5 SASI_Rn01_00135070 predicted 578
6 SASI_Rn01_00135071 predicted 989
7 SASI_Rn01_00135072 predicted 1118
8 SASI_Rn01_00135073 predicted 1209
9 SASI_Rn02_00417519 predicted 810
10 SASI_Rn01_00135075 predicted 524
11 SASI_Rn01_00135074 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159861 predicted 1381
2 SASI_Mm02_00346348 predicted 371
3 SASI_Mm01_00159863 predicted 778
4 SASI_Mm01_00159864 predicted 788
5 SASI_Mm01_00159865 predicted 1098
6 SASI_Mm02_00346349 predicted 365
7 SASI_Mm01_00159867 predicted 821
8 SASI_Mm02_00346350 predicted 1704
9 SASI_Mm01_00159869 predicted 1153
10 SASI_Mm02_00346351 predicted 1534
11 SASI_Mm01_00159862 predicted 1278
12 SASI_Mm01_00159866 predicted 1157
13 SASI_Mm01_00159868 predicted 1179
14 SASI_Mm01_00159870 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032441
ZMAT1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032441.1-5312s21c1
Sequence:CCGGCACTTCAGGAAAGCTATTTAACTCGAGTTAAATAGCTTTCCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4335s21c1
Sequence:CCGGGACCTATTCAGGACCATATAGCTCGAGCTATATGGTCCTGAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4571s21c1
Sequence:CCGGACCATCAAGCAGGTCATAAACCTCGAGGTTTATGACCTGCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-4076s1c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-3823s21c1
Sequence:CCGGTACGCAGCACCATACAATATTCTCGAGAATATTGTATGGTGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4076s21c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4130s1c1
Sequence:CCGGCAACCCATTCAAAGAGGACATCTCGAGATGTCCTCTTTGAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5748s1c1
Sequence:CCGGGCTCATCAAATTGCTGTGATACTCGAGTATCACAGCAATTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5080s1c1
Sequence:CCGGCCAAACTTAACCTCTGAGAAACTCGAGTTTCTCAGAGGTTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5722s1c1
Sequence:CCGGCCCTAAATGAAGTTGTCTCTACTCGAGTAGAGACAACTTCATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4405s1c1
Sequence:CCGGGATAGCAAACAGAGACTAGATCTCGAGATCTAGTCTCTGTTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-3976s1c1
Sequence:CCGGGAGAACTCTGTGGATACTCATCTCGAGATGAGTATCCACAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-3562s1c1
Sequence:CCGGCACATGCAAGGAAGTGAACATCTCGAGATGTTCACTTCCTTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5079s1c1
Sequence:CCGGCCCAAACTTAACCTCTGAGAACTCGAGTTCTCAGAGGTTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032441
ZMAT1 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032441.1-5312s21c1
Sequence:CCGGCACTTCAGGAAAGCTATTTAACTCGAGTTAAATAGCTTTCCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4335s21c1
Sequence:CCGGGACCTATTCAGGACCATATAGCTCGAGCTATATGGTCCTGAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4571s21c1
Sequence:CCGGACCATCAAGCAGGTCATAAACCTCGAGGTTTATGACCTGCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-4076s1c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-3823s21c1
Sequence:CCGGTACGCAGCACCATACAATATTCTCGAGAATATTGTATGGTGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4076s21c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4130s1c1
Sequence:CCGGCAACCCATTCAAAGAGGACATCTCGAGATGTCCTCTTTGAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5748s1c1
Sequence:CCGGGCTCATCAAATTGCTGTGATACTCGAGTATCACAGCAATTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5080s1c1
Sequence:CCGGCCAAACTTAACCTCTGAGAAACTCGAGTTTCTCAGAGGTTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5722s1c1
Sequence:CCGGCCCTAAATGAAGTTGTCTCTACTCGAGTAGAGACAACTTCATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4405s1c1
Sequence:CCGGGATAGCAAACAGAGACTAGATCTCGAGATCTAGTCTCTGTTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-3976s1c1
Sequence:CCGGGAGAACTCTGTGGATACTCATCTCGAGATGAGTATCCACAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-3562s1c1
Sequence:CCGGCACATGCAAGGAAGTGAACATCTCGAGATGTTCACTTCCTTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5079s1c1
Sequence:CCGGCCCAAACTTAACCTCTGAGAACTCGAGTTCTCAGAGGTTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032441
ZMAT1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032441.1-5312s21c1
Sequence:CCGGCACTTCAGGAAAGCTATTTAACTCGAGTTAAATAGCTTTCCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4335s21c1
Sequence:CCGGGACCTATTCAGGACCATATAGCTCGAGCTATATGGTCCTGAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4571s21c1
Sequence:CCGGACCATCAAGCAGGTCATAAACCTCGAGGTTTATGACCTGCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-4076s1c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-3823s21c1
Sequence:CCGGTACGCAGCACCATACAATATTCTCGAGAATATTGTATGGTGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032441.1-4076s21c1
Sequence:CCGGACCAACGACCATACCATATTTCTCGAGAAATATGGTATGGTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4130s1c1
Sequence:CCGGCAACCCATTCAAAGAGGACATCTCGAGATGTCCTCTTTGAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5748s1c1
Sequence:CCGGGCTCATCAAATTGCTGTGATACTCGAGTATCACAGCAATTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032441.1-5080s1c1
Sequence:CCGGCCAAACTTAACCTCTGAGAAACTCGAGTTTCTCAGAGGTTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5722s1c1
Sequence:CCGGCCCTAAATGAAGTTGTCTCTACTCGAGTAGAGACAACTTCATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-4405s1c1
Sequence:CCGGGATAGCAAACAGAGACTAGATCTCGAGATCTAGTCTCTGTTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032441.1-3976s1c1
Sequence:CCGGGAGAACTCTGTGGATACTCATCTCGAGATGAGTATCCACAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032441.1-3562s1c1
Sequence:CCGGCACATGCAAGGAAGTGAACATCTCGAGATGTTCACTTCCTTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032441.1-5079s1c1
Sequence:CCGGCCCAAACTTAACCTCTGAGAACTCGAGTTCTCAGAGGTTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175446
ZMAT1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-916s1c1
Sequence:CCGGCAGTATCACCTTTACATCTTTCTCGAGAAAGATGTAAAGGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175446.2-1739s1c1
Sequence:CCGGCCAGACTTACACAGATCCATACTCGAGTATGGATCTGTGTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1378s1c1
Sequence:CCGGGATGTCAGAAAGCTATAGGTACTCGAGTACCTATAGCTTTCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1256s1c1
Sequence:CCGGGAGCAGTTACCTCACAATTTACTCGAGTAAATTGTGAGGTAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175446
ZMAT1 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-916s1c1
Sequence:CCGGCAGTATCACCTTTACATCTTTCTCGAGAAAGATGTAAAGGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175446.2-1739s1c1
Sequence:CCGGCCAGACTTACACAGATCCATACTCGAGTATGGATCTGTGTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1378s1c1
Sequence:CCGGGATGTCAGAAAGCTATAGGTACTCGAGTACCTATAGCTTTCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1256s1c1
Sequence:CCGGGAGCAGTTACCTCACAATTTACTCGAGTAAATTGTGAGGTAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175446
ZMAT1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-916s1c1
Sequence:CCGGCAGTATCACCTTTACATCTTTCTCGAGAAAGATGTAAAGGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175446.2-1739s1c1
Sequence:CCGGCCAGACTTACACAGATCCATACTCGAGTATGGATCTGTGTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1378s1c1
Sequence:CCGGGATGTCAGAAAGCTATAGGTACTCGAGTACCTATAGCTTTCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175446.2-1256s1c1
Sequence:CCGGGAGCAGTTACCTCACAATTTACTCGAGTAAATTGTGAGGTAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks