EMAIL THIS PAGE TO A FRIEND

ZMAT2

zinc finger, matrin-type 2

Synonyms: Ptg-12 Snu23 hSNU23
UniProtKB ID: Q96NC0
Gene ID:
Mouse(66492) zinc finger, matrin type 2
Rat(679898) zinc finger, matrin type 2
naked mole-rat(101715051) zinc finger, matrin-type 2
domestic guinea pig(100731877) zinc finger, matrin-type 2
cow(782132) zinc finger, matrin-type 2
sheep(101122023) zinc finger, matrin-type 2
Zebrafish(324476) zinc finger, matrin type 2
chicken(427602) zinc finger, matrin-type 2
dog(607047) zinc finger, matrin-type 2
domestic cat(101098681) zinc finger, matrin-type 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144723 Rosetta Predictions human pricing
XM_001054881 Rosetta Predictions rat pricing
NM_025594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148625 predicted 946
2 SASI_Hs01_00148626 predicted 1074
3 SASI_Hs01_00148627 predicted 969
4 SASI_Hs01_00148628 predicted 934
5 SASI_Hs02_00364672 predicted 1014
6 SASI_Hs01_00148629 predicted 947
7 SASI_Hs02_00364673 predicted 1081
8 SASI_Hs01_00148630 predicted 1009
9 SASI_Hs01_00148631 predicted 1040
10 SASI_Hs01_00148632 predicted 957
11 SASI_Hs01_00148633 predicted 297
12 SASI_Hs01_00148634 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277621 predicted 1158
2 SASI_Rn02_00277622 predicted 1305
3 SASI_Rn02_00277623 predicted 1072
4 SASI_Rn02_00277624 predicted 239
5 SASI_Rn02_00277625 predicted 1125
6 SASI_Rn02_00277626 predicted 273
7 SASI_Rn02_00277627 predicted 1439
8 SASI_Rn02_00277628 predicted 1080
9 SASI_Rn02_00277629 predicted 202
10 SASI_Rn02_00277630 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328587 predicted 1108
2 SASI_Mm01_00106114 predicted 746
3 SASI_Mm01_00106115 predicted 639
4 SASI_Mm01_00106116 predicted 608
5 SASI_Mm02_00328588 predicted 906
6 SASI_Mm01_00106117 predicted 783
7 SASI_Mm01_00106118 predicted 336
8 SASI_Mm01_00106119 predicted 653
9 SASI_Mm02_00328589 predicted 649
10 SASI_Mm01_00106120 predicted 712
11 SASI_Mm01_00106112 predicted 1105
12 SASI_Mm01_00106113 predicted 806
13 SASI_Mm01_00106121 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025594
VALIDATED
ZMAT2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-56s1c1
Sequence:CCGGCGCCGAAAGTGGGACAAAGATCTCGAGATCTTTGTCCCACTTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-279s1c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025594.2-621s1c1
Sequence:CCGGGCGTTCTCTTTGGCCTAACTTCTCGAGAAGTTAGGCCAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-213s1c1
Sequence:CCGGCGATTGTTATCACCAAGACGACTCGAGTCGTCTTGGTGATAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-419s1c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-367s21c1
Sequence:CCGGCTCCACTCTGGATCAGGTAAACTCGAGTTTACCTGATCCAGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-419s21c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-279s21c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-331s21c1
Sequence:CCGGTCAGCGAAACCTGGGTATGTCCTCGAGGACATACCCAGGTTTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025594.3-1022s21c1
Sequence:CCGGAGTCTGCGGGTACTGGTATACCTCGAGGTATACCAGTACCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025594
VALIDATED
ZMAT2 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-56s1c1
Sequence:CCGGCGCCGAAAGTGGGACAAAGATCTCGAGATCTTTGTCCCACTTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-279s1c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025594.2-621s1c1
Sequence:CCGGGCGTTCTCTTTGGCCTAACTTCTCGAGAAGTTAGGCCAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-213s1c1
Sequence:CCGGCGATTGTTATCACCAAGACGACTCGAGTCGTCTTGGTGATAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-419s1c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-367s21c1
Sequence:CCGGCTCCACTCTGGATCAGGTAAACTCGAGTTTACCTGATCCAGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-419s21c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-279s21c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-331s21c1
Sequence:CCGGTCAGCGAAACCTGGGTATGTCCTCGAGGACATACCCAGGTTTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025594.3-1022s21c1
Sequence:CCGGAGTCTGCGGGTACTGGTATACCTCGAGGTATACCAGTACCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025594
VALIDATED
ZMAT2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-56s1c1
Sequence:CCGGCGCCGAAAGTGGGACAAAGATCTCGAGATCTTTGTCCCACTTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-279s1c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025594.2-621s1c1
Sequence:CCGGGCGTTCTCTTTGGCCTAACTTCTCGAGAAGTTAGGCCAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-213s1c1
Sequence:CCGGCGATTGTTATCACCAAGACGACTCGAGTCGTCTTGGTGATAACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025594.2-419s1c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-367s21c1
Sequence:CCGGCTCCACTCTGGATCAGGTAAACTCGAGTTTACCTGATCCAGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-419s21c1
Sequence:CCGGGAAGAGAAGCAGAAAGATTATCTCGAGATAATCTTTCTGCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-279s21c1
Sequence:CCGGGTGTGGTGAAAGACTCCATTACTCGAGTAATGGAGTCTTTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025594.3-331s21c1
Sequence:CCGGTCAGCGAAACCTGGGTATGTCCTCGAGGACATACCCAGGTTTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025594.3-1022s21c1
Sequence:CCGGAGTCTGCGGGTACTGGTATACCTCGAGGTATACCAGTACCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144723
VALIDATED
ZMAT2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144723.x-914s1c1
Sequence:CCGGCCTGCATCTTTATCTCTTCATCTCGAGATGAAGAGATAAAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-417s1c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-487s1c1
Sequence:CCGGCGTACAAGAAAGAGAAACAGACTCGAGTCTGTTTCTCTTTCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144723.x-396s1c1
Sequence:CCGGGTCAACAAGAAGAAGATGGAACTCGAGTTCCATCTTCTTCTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-236s21c1
Sequence:CCGGATCTGAGATGGGAGGATATTACTCGAGTAATATCCTCCCATCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-417s21c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-292s21c1
Sequence:CCGGTCAACTTTCTGGATCACATTACTCGAGTAATGTGATCCAGAAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-794s21c1
Sequence:CCGGAGGTAATGCTGTGGCATATTGCTCGAGCAATATGCCACAGCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-49s21c1
Sequence:CCGGTTCGCCGAAAGTGGGACAAAGCTCGAGCTTTGTCCCACTTTCGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144723
VALIDATED
ZMAT2 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144723.x-914s1c1
Sequence:CCGGCCTGCATCTTTATCTCTTCATCTCGAGATGAAGAGATAAAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-417s1c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-487s1c1
Sequence:CCGGCGTACAAGAAAGAGAAACAGACTCGAGTCTGTTTCTCTTTCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144723.x-396s1c1
Sequence:CCGGGTCAACAAGAAGAAGATGGAACTCGAGTTCCATCTTCTTCTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-236s21c1
Sequence:CCGGATCTGAGATGGGAGGATATTACTCGAGTAATATCCTCCCATCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-417s21c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-292s21c1
Sequence:CCGGTCAACTTTCTGGATCACATTACTCGAGTAATGTGATCCAGAAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-794s21c1
Sequence:CCGGAGGTAATGCTGTGGCATATTGCTCGAGCAATATGCCACAGCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-49s21c1
Sequence:CCGGTTCGCCGAAAGTGGGACAAAGCTCGAGCTTTGTCCCACTTTCGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144723
VALIDATED
ZMAT2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144723.x-914s1c1
Sequence:CCGGCCTGCATCTTTATCTCTTCATCTCGAGATGAAGAGATAAAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-417s1c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144723.x-487s1c1
Sequence:CCGGCGTACAAGAAAGAGAAACAGACTCGAGTCTGTTTCTCTTTCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144723.x-396s1c1
Sequence:CCGGGTCAACAAGAAGAAGATGGAACTCGAGTTCCATCTTCTTCTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-236s21c1
Sequence:CCGGATCTGAGATGGGAGGATATTACTCGAGTAATATCCTCCCATCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-417s21c1
Sequence:CCGGGAGAAGCAGAAGGATTATGATCTCGAGATCATAATCCTTCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-292s21c1
Sequence:CCGGTCAACTTTCTGGATCACATTACTCGAGTAATGTGATCCAGAAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_144723.1-794s21c1
Sequence:CCGGAGGTAATGCTGTGGCATATTGCTCGAGCAATATGCCACAGCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144723.1-49s21c1
Sequence:CCGGTTCGCCGAAAGTGGGACAAAGCTCGAGCTTTGTCCCACTTTCGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks