EMAIL THIS PAGE TO A FRIEND

ZMAT3

zinc finger, matrin-type 3

Synonyms: PAG608 WIG-1 WIG1
UniProtKB ID: Q9HA38, B3KVA6, D3DNR1, Q96A21
Gene ID:
Human(64393) Summary: This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Mouse(22401) zinc finger matrin type 3
Rat(64394) zinc finger, matrin type 3
chicken(425428) zinc finger, matrin-type 3
domestic cat(101097664) zinc finger, matrin-type 3
dog(488083) zinc finger, matrin-type 3
cow(538512) zinc finger, matrin-type 3
sheep(101110288) zinc finger, matrin-type 3
domestic guinea pig(100724286) zinc finger, matrin-type 3
naked mole-rat(101710711) zinc finger, matrin-type 3
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011291 MISSION® esiRNA esiRNA targeting mouse Zmat3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022470 Rosetta Predictions human pricing
NM_152240 Rosetta Predictions human pricing
NM_022548 Rosetta Predictions rat pricing
NM_009517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244544 predicted 685
2 SASI_Hs01_00244545 predicted 668
3 SASI_Hs01_00244546 predicted 548
4 SASI_Hs01_00244547 predicted 1598
5 SASI_Hs02_00355745 predicted 670
6 SASI_Hs01_00244548 predicted 638
7 SASI_Hs02_00355746 predicted 483
8 SASI_Hs01_00244552 predicted 540
9 SASI_Hs01_00244553 predicted 508
10 SASI_Hs02_00355747 predicted 685
11 SASI_Hs01_00244549 predicted 574
12 SASI_Hs01_00244550 predicted 1507
13 SASI_Hs01_00244551 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243175 predicted 583
2 SASI_Hs01_00243176 predicted 561
3 SASI_Hs01_00243177 predicted 437
4 SASI_Hs01_00243178 predicted 1484
5 SASI_Hs02_00365738 predicted 562
6 SASI_Hs01_00243179 predicted 535
7 SASI_Hs02_00365739 predicted 379
8 SASI_Hs01_00243183 predicted 435
9 SASI_Hs01_00243184 predicted 409
10 SASI_Hs02_00365740 predicted 579
11 SASI_Hs01_00243180 predicted 458
12 SASI_Hs01_00243181 predicted 1397
13 SASI_Hs01_00243182 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073637 predicted 1489
2 SASI_Rn02_00263322 predicted 648
3 SASI_Rn01_00073638 predicted 1375
4 SASI_Rn01_00073639 predicted 915
5 SASI_Rn01_00073640 predicted 729
6 SASI_Rn01_00073641 predicted 1460
7 SASI_Rn01_00073642 predicted 806
8 SASI_Rn01_00073643 predicted 802
9 SASI_Rn01_00073644 predicted 1496
10 SASI_Rn01_00073645 predicted 1389
11 SASI_Rn01_00073646 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100769 predicted 807
2 SASI_Mm01_00100770 predicted 1316
3 SASI_Mm02_00316315 predicted 993
4 SASI_Mm01_00100771 predicted 864
5 SASI_Mm02_00316316 predicted 1046
6 SASI_Mm01_00100772 predicted 913
7 SASI_Mm01_00100773 predicted 649
8 SASI_Mm01_00100774 predicted 1142
9 SASI_Mm01_00100775 predicted 304
10 SASI_Mm01_00100776 predicted 1336
11 SASI_Mm01_00100768 predicted 816
12 SASI_Mm01_00100777 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022470
VALIDATED
ZMAT3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022470.2-1357s21c1
Sequence:CCGGATGGTGTTGAGCCGCTCATAGCTCGAGCTATGAGCGGCTCAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-689s21c1
Sequence:CCGGACGGAGAATGATTACTGTAAGCTCGAGCTTACAGTAATCATTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-794s21c1
Sequence:CCGGGAAGCTCAGAGTAACTCATTCCTCGAGGAATGAGTTACTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-507s21c1
Sequence:CCGGAGCAAGCCCAGGCTCATTATCCTCGAGGATAATGAGCCTGGGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-643s21c1
Sequence:CCGGTCCGCAGATGGGCTCCTTTAACTCGAGTTAAAGGAGCCCATCTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-407s1c1
Sequence:CCGGGAAGAAGAGTTATCGAAGGGACTCGAGTCCCTTCGATAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-539s1c1
Sequence:CCGGCATGGTAAGAAACTCCGAAATCTCGAGATTTCGGAGTTTCTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-1872s1c1
Sequence:CCGGCCCATCATTGAAGCGCAAATTCTCGAGAATTTGCGCTTCAATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-1049s1c1
Sequence:CCGGCATTTAGAGAGCAAGCAACATCTCGAGATGTTGCTTGCTCTCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-2021s1c1
Sequence:CCGGGCTTGTCTAACAAGCCCATTTCTCGAGAAATGGGCTTGTTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022470
VALIDATED
ZMAT3 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022470.2-1357s21c1
Sequence:CCGGATGGTGTTGAGCCGCTCATAGCTCGAGCTATGAGCGGCTCAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-689s21c1
Sequence:CCGGACGGAGAATGATTACTGTAAGCTCGAGCTTACAGTAATCATTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-794s21c1
Sequence:CCGGGAAGCTCAGAGTAACTCATTCCTCGAGGAATGAGTTACTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-507s21c1
Sequence:CCGGAGCAAGCCCAGGCTCATTATCCTCGAGGATAATGAGCCTGGGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-643s21c1
Sequence:CCGGTCCGCAGATGGGCTCCTTTAACTCGAGTTAAAGGAGCCCATCTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-407s1c1
Sequence:CCGGGAAGAAGAGTTATCGAAGGGACTCGAGTCCCTTCGATAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-539s1c1
Sequence:CCGGCATGGTAAGAAACTCCGAAATCTCGAGATTTCGGAGTTTCTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-1872s1c1
Sequence:CCGGCCCATCATTGAAGCGCAAATTCTCGAGAATTTGCGCTTCAATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-1049s1c1
Sequence:CCGGCATTTAGAGAGCAAGCAACATCTCGAGATGTTGCTTGCTCTCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-2021s1c1
Sequence:CCGGGCTTGTCTAACAAGCCCATTTCTCGAGAAATGGGCTTGTTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022470
VALIDATED
ZMAT3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022470.2-1357s21c1
Sequence:CCGGATGGTGTTGAGCCGCTCATAGCTCGAGCTATGAGCGGCTCAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-689s21c1
Sequence:CCGGACGGAGAATGATTACTGTAAGCTCGAGCTTACAGTAATCATTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-794s21c1
Sequence:CCGGGAAGCTCAGAGTAACTCATTCCTCGAGGAATGAGTTACTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-507s21c1
Sequence:CCGGAGCAAGCCCAGGCTCATTATCCTCGAGGATAATGAGCCTGGGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022470.2-643s21c1
Sequence:CCGGTCCGCAGATGGGCTCCTTTAACTCGAGTTAAAGGAGCCCATCTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-407s1c1
Sequence:CCGGGAAGAAGAGTTATCGAAGGGACTCGAGTCCCTTCGATAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-539s1c1
Sequence:CCGGCATGGTAAGAAACTCCGAAATCTCGAGATTTCGGAGTTTCTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-1872s1c1
Sequence:CCGGCCCATCATTGAAGCGCAAATTCTCGAGAATTTGCGCTTCAATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_022470.2-1049s1c1
Sequence:CCGGCATTTAGAGAGCAAGCAACATCTCGAGATGTTGCTTGCTCTCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022470.2-2021s1c1
Sequence:CCGGGCTTGTCTAACAAGCCCATTTCTCGAGAAATGGGCTTGTTAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009517
VALIDATED
ZMAT3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1371s21c1
Sequence:CCGGTGACTAGAGCTACGATTATTTCTCGAGAAATAATCGTAGCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1449s21c1
Sequence:CCGGAGTTCTTACTTCCAATTATAGCTCGAGCTATAATTGGAAGTAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1155s21c1
Sequence:CCGGTGGTCCTCCATGCGTACATTCCTCGAGGAATGTACGCATGGAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009517.1-7208s1c1
Sequence:CCGGGCCGAGAGAATGTGAACCTTTCTCGAGAAAGGTTCACATTCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-765s1c1
Sequence:CCGGCGGAAAGAAGGGAGTGAATTTCTCGAGAAATTCACTCCCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-453s1c1
Sequence:CCGGCATGGCAAGAAACTACGAAATCTCGAGATTTCGTAGTTTCTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-202s1c1
Sequence:CCGGCTTTACCTAATCGGCCTTCAACTCGAGTTGAAGGCCGATTAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009517.1-604s1c1
Sequence:CCGGCTACAGAGAATGACTACTGTACTCGAGTACAGTAGTCATTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009517
VALIDATED
ZMAT3 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1371s21c1
Sequence:CCGGTGACTAGAGCTACGATTATTTCTCGAGAAATAATCGTAGCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1449s21c1
Sequence:CCGGAGTTCTTACTTCCAATTATAGCTCGAGCTATAATTGGAAGTAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1155s21c1
Sequence:CCGGTGGTCCTCCATGCGTACATTCCTCGAGGAATGTACGCATGGAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009517.1-7208s1c1
Sequence:CCGGGCCGAGAGAATGTGAACCTTTCTCGAGAAAGGTTCACATTCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-765s1c1
Sequence:CCGGCGGAAAGAAGGGAGTGAATTTCTCGAGAAATTCACTCCCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-453s1c1
Sequence:CCGGCATGGCAAGAAACTACGAAATCTCGAGATTTCGTAGTTTCTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-202s1c1
Sequence:CCGGCTTTACCTAATCGGCCTTCAACTCGAGTTGAAGGCCGATTAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009517.1-604s1c1
Sequence:CCGGCTACAGAGAATGACTACTGTACTCGAGTACAGTAGTCATTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009517
VALIDATED
ZMAT3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1371s21c1
Sequence:CCGGTGACTAGAGCTACGATTATTTCTCGAGAAATAATCGTAGCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1449s21c1
Sequence:CCGGAGTTCTTACTTCCAATTATAGCTCGAGCTATAATTGGAAGTAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009517.2-1155s21c1
Sequence:CCGGTGGTCCTCCATGCGTACATTCCTCGAGGAATGTACGCATGGAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009517.1-7208s1c1
Sequence:CCGGGCCGAGAGAATGTGAACCTTTCTCGAGAAAGGTTCACATTCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-765s1c1
Sequence:CCGGCGGAAAGAAGGGAGTGAATTTCTCGAGAAATTCACTCCCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-453s1c1
Sequence:CCGGCATGGCAAGAAACTACGAAATCTCGAGATTTCGTAGTTTCTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009517.1-202s1c1
Sequence:CCGGCTTTACCTAATCGGCCTTCAACTCGAGTTGAAGGCCGATTAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009517.1-604s1c1
Sequence:CCGGCTACAGAGAATGACTACTGTACTCGAGTACAGTAGTCATTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks