EMAIL THIS PAGE TO A FRIEND

ZMAT4

zinc finger, matrin-type 4

UniProtKB ID: Q9H898, Q8WUT8
Gene ID:
Mouse(320158) zinc finger, matrin type 4
Rat(684961) zinc finger, matrin type 4
naked mole-rat(101720694) zinc finger, matrin-type 4
domestic guinea pig(100726632) zinc finger, matrin-type 4
cow(616397) zinc finger, matrin-type 4
sheep(101116280) zinc finger, matrin-type 4
chicken(426786) zinc finger, matrin-type 4
dog(607579) zinc finger, matrin-type 4
domestic cat(101083841) zinc finger, matrin-type 4
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024645 Rosetta Predictions human pricing
NM_001134747 Rosetta Predictions rat pricing
NM_177086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044445 predicted 538
2 SASI_Hs01_00044446 predicted 542
3 SASI_Hs01_00044447 predicted 569
4 SASI_Hs01_00044448 predicted 720
5 SASI_Hs02_00357039 predicted 295
6 SASI_Hs01_00044449 predicted 761
7 SASI_Hs01_00044450 predicted 266
8 SASI_Hs02_00357040 predicted 754
9 SASI_Hs01_00044451 predicted 368
10 SASI_Hs02_00357041 predicted 264
11 SASI_Hs01_00044452 predicted 740
12 SASI_Hs01_00044453 predicted 352
13 SASI_Hs01_00044454 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258314 predicted 816
2 SASI_Rn02_00258315 predicted 849
3 SASI_Rn02_00258316 predicted 242
4 SASI_Rn02_00258317 predicted 1087
5 SASI_Rn02_00258318 predicted 928
6 SASI_Rn02_00258319 predicted 1001
7 SASI_Rn02_00258320 predicted 1066
8 SASI_Rn02_00258321 predicted 1056
9 SASI_Rn02_00258322 predicted 932
10 SASI_Rn02_00258323 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153739 predicted 976
2 SASI_Mm01_00153740 predicted 473
3 SASI_Mm01_00153741 predicted 794
4 SASI_Mm01_00153742 predicted 1036
5 SASI_Mm01_00153744 predicted 833
6 SASI_Mm01_00153745 predicted 1071
7 SASI_Mm02_00347071 predicted 980
8 SASI_Mm01_00153747 predicted 800
9 SASI_Mm01_00153748 predicted 818
10 SASI_Mm02_00347072 predicted 751
11 SASI_Mm01_00153743 predicted 438
12 SASI_Mm01_00153746 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024645
ZMAT4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-884s1c1
Sequence:CCGGCCGTGGAGAATTGCTTATCAACTCGAGTTGATAAGCAATTCTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-416s1c1
Sequence:CCGGCGATTCCCATTATCAAGGCAACTCGAGTTGCCTTGATAATGGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-1533s1c1
Sequence:CCGGGCCTGCATGATGATCTTCTTACTCGAGTAAGAAGATCATCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-415s1c1
Sequence:CCGGCCGATTCCCATTATCAAGGCACTCGAGTGCCTTGATAATGGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-659s1c1
Sequence:CCGGGAATGCGGCAAGAGTTGCTTTCTCGAGAAAGCAACTCTTGCCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-663s1c1
Sequence:CCGGGCGGCAAGAGTTGCTTTGTTACTCGAGTAACAAAGCAACTCTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-261s1c1
Sequence:CCGGGCAAGCAAAGTCCGACTGTATCTCGAGATACAGTCGGACTTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-719s21c1
Sequence:CCGGGAGAGGTCTGAGGCGCAATTACTCGAGTAATTGCGCCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-545s21c1
Sequence:CCGGGGTCGCATCTCCCTATCAAAGCTCGAGCTTTGATAGGGAGATGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1297s21c1
Sequence:CCGGGAACTGGAACAGATCACTATTCTCGAGAATAGTGATCTGTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1176s21c1
Sequence:CCGGAGATTTCCTCAGAGCATAATTCTCGAGAATTATGCTCTGAGGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024645
ZMAT4 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-884s1c1
Sequence:CCGGCCGTGGAGAATTGCTTATCAACTCGAGTTGATAAGCAATTCTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-416s1c1
Sequence:CCGGCGATTCCCATTATCAAGGCAACTCGAGTTGCCTTGATAATGGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-1533s1c1
Sequence:CCGGGCCTGCATGATGATCTTCTTACTCGAGTAAGAAGATCATCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-415s1c1
Sequence:CCGGCCGATTCCCATTATCAAGGCACTCGAGTGCCTTGATAATGGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-659s1c1
Sequence:CCGGGAATGCGGCAAGAGTTGCTTTCTCGAGAAAGCAACTCTTGCCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-663s1c1
Sequence:CCGGGCGGCAAGAGTTGCTTTGTTACTCGAGTAACAAAGCAACTCTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-261s1c1
Sequence:CCGGGCAAGCAAAGTCCGACTGTATCTCGAGATACAGTCGGACTTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-719s21c1
Sequence:CCGGGAGAGGTCTGAGGCGCAATTACTCGAGTAATTGCGCCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-545s21c1
Sequence:CCGGGGTCGCATCTCCCTATCAAAGCTCGAGCTTTGATAGGGAGATGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1297s21c1
Sequence:CCGGGAACTGGAACAGATCACTATTCTCGAGAATAGTGATCTGTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1176s21c1
Sequence:CCGGAGATTTCCTCAGAGCATAATTCTCGAGAATTATGCTCTGAGGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024645
ZMAT4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-884s1c1
Sequence:CCGGCCGTGGAGAATTGCTTATCAACTCGAGTTGATAAGCAATTCTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-416s1c1
Sequence:CCGGCGATTCCCATTATCAAGGCAACTCGAGTTGCCTTGATAATGGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024645.1-1533s1c1
Sequence:CCGGGCCTGCATGATGATCTTCTTACTCGAGTAAGAAGATCATCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-415s1c1
Sequence:CCGGCCGATTCCCATTATCAAGGCACTCGAGTGCCTTGATAATGGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-659s1c1
Sequence:CCGGGAATGCGGCAAGAGTTGCTTTCTCGAGAAAGCAACTCTTGCCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024645.1-663s1c1
Sequence:CCGGGCGGCAAGAGTTGCTTTGTTACTCGAGTAACAAAGCAACTCTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024645.1-261s1c1
Sequence:CCGGGCAAGCAAAGTCCGACTGTATCTCGAGATACAGTCGGACTTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-719s21c1
Sequence:CCGGGAGAGGTCTGAGGCGCAATTACTCGAGTAATTGCGCCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024645.2-545s21c1
Sequence:CCGGGGTCGCATCTCCCTATCAAAGCTCGAGCTTTGATAGGGAGATGCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1297s21c1
Sequence:CCGGGAACTGGAACAGATCACTATTCTCGAGAATAGTGATCTGTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024645.2-1176s21c1
Sequence:CCGGAGATTTCCTCAGAGCATAATTCTCGAGAATTATGCTCTGAGGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177086
ZMAT4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-726s1c1
Sequence:CCGGGTGTCGCTCAACTCCATAGAACTCGAGTTCTATGGAGTTGAGCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-747s1c1
Sequence:CCGGCAGTATCATGCACATCTGCAACTCGAGTTGCAGATGTGCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-522s1c1
Sequence:CCGGCCCTATCAAAGAAGAGACTCACTCGAGTGAGTCTCTTCTTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-324s1c1
Sequence:CCGGGTGGATAAGAATAAATGCTGTCTCGAGACAGCATTTATTCTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-732s1c1
Sequence:CCGGCTCAACTCCATAGAACAGTATCTCGAGATACTGTTCTATGGAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177086.1-3163s1c1
Sequence:CCGGGCCTCCTGTTAAATCGAGATACTCGAGTATCTCGATTTAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-686s1c1
Sequence:CCGGGAGAGGTCTGAGACGTACTTACTCGAGTAAGTACGTCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177086.1-1452s1c1
Sequence:CCGGGCCAGATCATAGCTTAGGAAACTCGAGTTTCCTAAGCTATGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177086.3-630s21c1
Sequence:CCGGAGCATTACGAAGGCAAGAAACCTCGAGGTTTCTTGCCTTCGTAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1216s21c1
Sequence:CCGGTAAGCCTCCTAGATCCATTAACTCGAGTTAATGGATCTAGGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1301s21c1
Sequence:CCGGTGTGGTCTGTAGAAGTTATATCTCGAGATATAACTTCTACAGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177086
ZMAT4 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-726s1c1
Sequence:CCGGGTGTCGCTCAACTCCATAGAACTCGAGTTCTATGGAGTTGAGCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-747s1c1
Sequence:CCGGCAGTATCATGCACATCTGCAACTCGAGTTGCAGATGTGCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-522s1c1
Sequence:CCGGCCCTATCAAAGAAGAGACTCACTCGAGTGAGTCTCTTCTTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-324s1c1
Sequence:CCGGGTGGATAAGAATAAATGCTGTCTCGAGACAGCATTTATTCTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-732s1c1
Sequence:CCGGCTCAACTCCATAGAACAGTATCTCGAGATACTGTTCTATGGAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177086.1-3163s1c1
Sequence:CCGGGCCTCCTGTTAAATCGAGATACTCGAGTATCTCGATTTAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-686s1c1
Sequence:CCGGGAGAGGTCTGAGACGTACTTACTCGAGTAAGTACGTCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177086.1-1452s1c1
Sequence:CCGGGCCAGATCATAGCTTAGGAAACTCGAGTTTCCTAAGCTATGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177086.3-630s21c1
Sequence:CCGGAGCATTACGAAGGCAAGAAACCTCGAGGTTTCTTGCCTTCGTAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1216s21c1
Sequence:CCGGTAAGCCTCCTAGATCCATTAACTCGAGTTAATGGATCTAGGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1301s21c1
Sequence:CCGGTGTGGTCTGTAGAAGTTATATCTCGAGATATAACTTCTACAGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177086
ZMAT4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-726s1c1
Sequence:CCGGGTGTCGCTCAACTCCATAGAACTCGAGTTCTATGGAGTTGAGCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-747s1c1
Sequence:CCGGCAGTATCATGCACATCTGCAACTCGAGTTGCAGATGTGCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-522s1c1
Sequence:CCGGCCCTATCAAAGAAGAGACTCACTCGAGTGAGTCTCTTCTTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-324s1c1
Sequence:CCGGGTGGATAAGAATAAATGCTGTCTCGAGACAGCATTTATTCTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177086.1-732s1c1
Sequence:CCGGCTCAACTCCATAGAACAGTATCTCGAGATACTGTTCTATGGAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177086.1-3163s1c1
Sequence:CCGGGCCTCCTGTTAAATCGAGATACTCGAGTATCTCGATTTAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177086.1-686s1c1
Sequence:CCGGGAGAGGTCTGAGACGTACTTACTCGAGTAAGTACGTCTCAGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177086.1-1452s1c1
Sequence:CCGGGCCAGATCATAGCTTAGGAAACTCGAGTTTCCTAAGCTATGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177086.3-630s21c1
Sequence:CCGGAGCATTACGAAGGCAAGAAACCTCGAGGTTTCTTGCCTTCGTAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1216s21c1
Sequence:CCGGTAAGCCTCCTAGATCCATTAACTCGAGTTAATGGATCTAGGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177086.3-1301s21c1
Sequence:CCGGTGTGGTCTGTAGAAGTTATATCTCGAGATATAACTTCTACAGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks