EMAIL THIS PAGE TO A FRIEND

ZMAT5

zinc finger, matrin-type 5

Synonyms: SNRNP20
UniProtKB ID: Q9UDW3, A8K9F6
Gene ID:
Mouse(67178) zinc finger, matrin type 5
Rat(501926) zinc finger, matrin type 5
Zebrafish(445314) zinc finger, matrin type 5
domestic cat(101088523) zinc finger, matrin-type 5
dog(477536) zinc finger, matrin-type 5
chicken(417017) zinc finger, matrin type 5
cow(616095) zinc finger, matrin-type 5
sheep(101108518) zinc finger, matrin-type 5
domestic guinea pig(100715087) zinc finger, matrin-type 5
naked mole-rat(101707792) zinc finger, matrin-type 5
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003692 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003692 Rosetta Predictions human pricing
NM_019103 Rosetta Predictions human pricing
XM_001067336 Rosetta Predictions rat pricing
XM_577351 Rosetta Predictions rat pricing
NM_026015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030882 predicted 413
2 SASI_Hs01_00030883 predicted 412
3 SASI_Hs02_00304321 predicted 532
4 SASI_Hs01_00030884 predicted 333
5 SASI_Hs01_00030885 predicted 509
6 SASI_Hs01_00030886 predicted 427
7 SASI_Hs01_00030888 predicted 483
8 SASI_Hs01_00030889 predicted 328
9 SASI_Hs01_00030890 predicted 417
10 SASI_Hs01_00030891 predicted 418
11 SASI_Hs01_00030887 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193005 predicted 529
2 SASI_Hs01_00193006 predicted 531
3 SASI_Hs02_00352726 predicted 643
4 SASI_Hs01_00193007 predicted 448
5 SASI_Hs01_00193008 predicted 629
6 SASI_Hs01_00193009 predicted 537
7 SASI_Hs01_00193011 predicted 599
8 SASI_Hs01_00193012 predicted 446
9 SASI_Hs01_00193013 predicted 527
10 SASI_Hs01_00193014 predicted 536
11 SASI_Hs01_00193010 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320740 predicted 203
2 SASI_Rn02_00320741 predicted 259
3 SASI_Rn02_00320742 predicted 202
4 SASI_Rn02_00320743 predicted 369
5 SASI_Rn02_00320744 predicted 326
6 SASI_Rn02_00320745 predicted 353
7 SASI_Rn02_00320746 predicted 375
8 SASI_Rn02_00320747 predicted 361
9 SASI_Rn02_00320748 predicted 218
10 SASI_Rn02_00320749 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406537 predicted 203
2 SASI_Rn02_00406538 predicted 259
3 SASI_Rn02_00406539 predicted 206
4 SASI_Rn02_00406540 predicted 367
5 SASI_Rn02_00406541 predicted 323
6 SASI_Rn02_00406542 predicted 348
7 SASI_Rn02_00406543 predicted 374
8 SASI_Rn02_00406544 predicted 364
9 SASI_Rn02_00406545 predicted 220
10 SASI_Rn02_00406546 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148477 predicted 547
2 SASI_Mm01_00148478 predicted 416
3 SASI_Mm01_00148479 predicted 448
4 SASI_Mm01_00148480 predicted 550
5 SASI_Mm01_00148481 predicted 258
6 SASI_Mm01_00148482 predicted 445
7 SASI_Mm01_00148483 predicted 541
8 SASI_Mm01_00148484 predicted 266
9 SASI_Mm01_00148485 predicted 201
10 SASI_Mm01_00148486 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003692
VALIDATED
ZMAT5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-193s21c1
Sequence:CCGGCAACCGCAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-338s21c1
Sequence:CCGGTTTGGCTCCAACTGCAGATTTCTCGAGAAATCTGCAGTTGGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-532s21c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-310s21c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-277s21c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003692.1-277s1c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-238s1c1
Sequence:CCGGGAAGGTCTGGTACGACATGTTCTCGAGAACATGTCGTACCAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-310s1c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-235s1c1
Sequence:CCGGCAAGAAGGTCTGGTACGACATCTCGAGATGTCGTACCAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-532s1c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-529s1c1
Sequence:CCGGCATCAGAACCACTGTCTTCCACTCGAGTGGAAGACAGTGGTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-303s1c1
Sequence:CCGGCCTGCAGGAAGTTTCTACTGACTCGAGTCAGTAGAAACTTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003692
VALIDATED
ZMAT5 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-193s21c1
Sequence:CCGGCAACCGCAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-338s21c1
Sequence:CCGGTTTGGCTCCAACTGCAGATTTCTCGAGAAATCTGCAGTTGGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-532s21c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-310s21c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-277s21c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003692.1-277s1c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-238s1c1
Sequence:CCGGGAAGGTCTGGTACGACATGTTCTCGAGAACATGTCGTACCAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-310s1c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-235s1c1
Sequence:CCGGCAAGAAGGTCTGGTACGACATCTCGAGATGTCGTACCAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-532s1c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-529s1c1
Sequence:CCGGCATCAGAACCACTGTCTTCCACTCGAGTGGAAGACAGTGGTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-303s1c1
Sequence:CCGGCCTGCAGGAAGTTTCTACTGACTCGAGTCAGTAGAAACTTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003692
VALIDATED
ZMAT5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-193s21c1
Sequence:CCGGCAACCGCAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-338s21c1
Sequence:CCGGTTTGGCTCCAACTGCAGATTTCTCGAGAAATCTGCAGTTGGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-532s21c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003692.1-310s21c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003692.1-277s21c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003692.1-277s1c1
Sequence:CCGGCTTGCTGGATGAGCAGAACAACTCGAGTTGTTCTGCTCATCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-238s1c1
Sequence:CCGGGAAGGTCTGGTACGACATGTTCTCGAGAACATGTCGTACCAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-310s1c1
Sequence:CCGGGAAGTTTCTACTGACAGGCCACTCGAGTGGCCTGTCAGTAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-235s1c1
Sequence:CCGGCAAGAAGGTCTGGTACGACATCTCGAGATGTCGTACCAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-532s1c1
Sequence:CCGGCAGAACCACTGTCTTCCAGTACTCGAGTACTGGAAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003692.1-529s1c1
Sequence:CCGGCATCAGAACCACTGTCTTCCACTCGAGTGGAAGACAGTGGTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001003692.1-303s1c1
Sequence:CCGGCCTGCAGGAAGTTTCTACTGACTCGAGTCAGTAGAAACTTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026015
VALIDATED
ZMAT5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, matrin-type 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-469s21c1
Sequence:CCGGGAACCACTGTCTTCCAGTATCCTCGAGGATACTGGAAGACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026015.2-619s21c1
Sequence:CCGGTGTCTCATCAGTCACAGTAAACTCGAGTTTACTGTGACTGATGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-181s21c1
Sequence:CCGGGGTACGACATGTTCCGAGATGCTCGAGCATCTCGGAACATGTCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-206s21c1
Sequence:CCGGTGCCATCTTGCTGGATGAACACTCGAGTGTTCATCCAGCAAGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-130s21c1
Sequence:CCGGACCGAAAGAAGCACCTGAATGCTCGAGCATTCAGGTGCTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-129s1c1
Sequence:CCGGCAACCGAAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-300s1c1
Sequence:CCGGCATGTCAGAACAAGATCTGCACTCGAGTGCAGATCTTGTTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026015
VALIDATED
ZMAT5 MISSION shRNA shRNA Plasmid DNA
zinc finger, matrin-type 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-469s21c1
Sequence:CCGGGAACCACTGTCTTCCAGTATCCTCGAGGATACTGGAAGACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026015.2-619s21c1
Sequence:CCGGTGTCTCATCAGTCACAGTAAACTCGAGTTTACTGTGACTGATGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-181s21c1
Sequence:CCGGGGTACGACATGTTCCGAGATGCTCGAGCATCTCGGAACATGTCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-206s21c1
Sequence:CCGGTGCCATCTTGCTGGATGAACACTCGAGTGTTCATCCAGCAAGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-130s21c1
Sequence:CCGGACCGAAAGAAGCACCTGAATGCTCGAGCATTCAGGTGCTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-129s1c1
Sequence:CCGGCAACCGAAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-300s1c1
Sequence:CCGGCATGTCAGAACAAGATCTGCACTCGAGTGCAGATCTTGTTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026015
VALIDATED
ZMAT5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, matrin-type 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-469s21c1
Sequence:CCGGGAACCACTGTCTTCCAGTATCCTCGAGGATACTGGAAGACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026015.2-619s21c1
Sequence:CCGGTGTCTCATCAGTCACAGTAAACTCGAGTTTACTGTGACTGATGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-181s21c1
Sequence:CCGGGGTACGACATGTTCCGAGATGCTCGAGCATCTCGGAACATGTCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-206s21c1
Sequence:CCGGTGCCATCTTGCTGGATGAACACTCGAGTGTTCATCCAGCAAGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026015.2-130s21c1
Sequence:CCGGACCGAAAGAAGCACCTGAATGCTCGAGCATTCAGGTGCTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-129s1c1
Sequence:CCGGCAACCGAAAGAAGCACCTGAACTCGAGTTCAGGTGCTTCTTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026015.1-300s1c1
Sequence:CCGGCATGTCAGAACAAGATCTGCACTCGAGTGCAGATCTTGTTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks