EMAIL THIS PAGE TO A FRIEND

ZMIZ1

zinc finger, MIZ-type containing 1

Synonyms: MIZ RAI17 TRAFIP10 ZIMP10 hZIMP10
UniProtKB ID: Q9ULJ6, Q5JSH9, Q7Z7E6
Gene ID:
Human(57178) Summary: This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
Mouse(328365) zinc finger, MIZ-type containing 1
Rat(361103) zinc finger, MIZ-type containing 1
naked mole-rat(101707333) zinc finger, MIZ-type containing 1
domestic guinea pig(100725491) zinc finger, MIZ-type containing 1
cow(616740) zinc finger, MIZ-type containing 1
sheep(101111251) zinc finger, MIZ-type containing 1
chicken(423724) zinc finger, MIZ-type containing 1
dog(489063) zinc finger, MIZ-type containing 1
domestic cat(101099328) zinc finger, MIZ-type containing 1
Horse(100064398) zinc finger, MIZ-type containing 1
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020338 Rosetta Predictions human pricing
NM_001108393 Rosetta Predictions rat pricing
NM_183208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353265 predicted 472
2 SASI_Hs01_00113122 predicted 289
3 SASI_Hs01_00113123 predicted 225
4 SASI_Hs01_00113124 predicted 1677
5 SASI_Hs01_00113125 predicted 2366
6 SASI_Hs01_00113126 predicted 1979
7 SASI_Hs01_00113127 predicted 3234
8 SASI_Hs01_00113128 predicted 1690
9 SASI_Hs01_00113129 predicted 1725
10 SASI_Hs01_00113130 predicted 3556
11 SASI_Hs01_00113131 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238219 predicted 2892
2 SASI_Rn02_00238220 predicted 1823
3 SASI_Rn02_00238221 predicted 2803
4 SASI_Rn02_00238222 predicted 1791
5 SASI_Rn02_00238223 predicted 625
6 SASI_Rn02_00238224 predicted 2220
7 SASI_Rn02_00238225 predicted 1151
8 SASI_Rn02_00238226 predicted 2866
9 SASI_Rn02_00238227 predicted 3069
10 SASI_Rn02_00238228 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194035 predicted 2816
2 SASI_Mm01_00194036 predicted 1743
3 SASI_Mm01_00194037 predicted 1486
4 SASI_Mm01_00194038 predicted 2145
5 SASI_Mm01_00194039 predicted 545
6 SASI_Mm01_00194040 predicted 2127
7 SASI_Mm01_00194041 predicted 1705
8 SASI_Mm01_00194042 predicted 1185
9 SASI_Mm01_00194043 predicted 1065
10 SASI_Mm02_00350315 predicted 3170
11 SASI_Mm01_00194044 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020338
ZMIZ1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MIZ-type containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1038s1c1
Sequence:CCGGCCAGGCGTATAACAGCCAATTCTCGAGAATTGGCTGTTATACGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1259s1c1
Sequence:CCGGCCCTTCCTATTCAGAACATAACTCGAGTTATGTTCTGAATAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1692s1c1
Sequence:CCGGGCCTGACATCAAGCCAAATATCTCGAGATATTTGGCTTGATGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-2634s1c1
Sequence:CCGGGCCCAATGTCATGGAGATGATCTCGAGATCATCTCCATGACATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-3246s1c1
Sequence:CCGGCCTCCTGTCTCTATTTGAGAACTCGAGTTCTCAAATAGAGACAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-3046s21c1
Sequence:CCGGTGCCCATCAAGTCGGACTTACCTCGAGGTAAGTCCGACTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-1980s21c1
Sequence:CCGGTACAAGCCAGAACAGTTTAATCTCGAGATTAAACTGTTCTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020338
ZMIZ1 MISSION shRNA shRNA Plasmid DNA
zinc finger, MIZ-type containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1038s1c1
Sequence:CCGGCCAGGCGTATAACAGCCAATTCTCGAGAATTGGCTGTTATACGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1259s1c1
Sequence:CCGGCCCTTCCTATTCAGAACATAACTCGAGTTATGTTCTGAATAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1692s1c1
Sequence:CCGGGCCTGACATCAAGCCAAATATCTCGAGATATTTGGCTTGATGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-2634s1c1
Sequence:CCGGGCCCAATGTCATGGAGATGATCTCGAGATCATCTCCATGACATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-3246s1c1
Sequence:CCGGCCTCCTGTCTCTATTTGAGAACTCGAGTTCTCAAATAGAGACAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-3046s21c1
Sequence:CCGGTGCCCATCAAGTCGGACTTACCTCGAGGTAAGTCCGACTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-1980s21c1
Sequence:CCGGTACAAGCCAGAACAGTTTAATCTCGAGATTAAACTGTTCTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020338
ZMIZ1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MIZ-type containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1038s1c1
Sequence:CCGGCCAGGCGTATAACAGCCAATTCTCGAGAATTGGCTGTTATACGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1259s1c1
Sequence:CCGGCCCTTCCTATTCAGAACATAACTCGAGTTATGTTCTGAATAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-1692s1c1
Sequence:CCGGGCCTGACATCAAGCCAAATATCTCGAGATATTTGGCTTGATGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-2634s1c1
Sequence:CCGGGCCCAATGTCATGGAGATGATCTCGAGATCATCTCCATGACATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020338.1-3246s1c1
Sequence:CCGGCCTCCTGTCTCTATTTGAGAACTCGAGTTCTCAAATAGAGACAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-3046s21c1
Sequence:CCGGTGCCCATCAAGTCGGACTTACCTCGAGGTAAGTCCGACTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020338.3-1980s21c1
Sequence:CCGGTACAAGCCAGAACAGTTTAATCTCGAGATTAAACTGTTCTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183208
ZMIZ1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MIZ-type containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2119s1c1
Sequence:CCGGCCAAGATGTCAAACCACCTTTCTCGAGAAAGGTGGTTTGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183208.2-4638s1c1
Sequence:CCGGGCTCTGAAGGAAAGGAACATTCTCGAGAATGTTCCTTTCCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2118s1c1
Sequence:CCGGGCCAAGATGTCAAACCACCTTCTCGAGAAGGTGGTTTGACATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2141s1c1
Sequence:CCGGCCACCTGATATCAAGCCAAATCTCGAGATTTGGCTTGATATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-3664s1c1
Sequence:CCGGCGACCTTCCAAGCAATAGCAACTCGAGTTGCTATTGCTTGGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183208
ZMIZ1 MISSION shRNA shRNA Plasmid DNA
zinc finger, MIZ-type containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2119s1c1
Sequence:CCGGCCAAGATGTCAAACCACCTTTCTCGAGAAAGGTGGTTTGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183208.2-4638s1c1
Sequence:CCGGGCTCTGAAGGAAAGGAACATTCTCGAGAATGTTCCTTTCCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2118s1c1
Sequence:CCGGGCCAAGATGTCAAACCACCTTCTCGAGAAGGTGGTTTGACATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2141s1c1
Sequence:CCGGCCACCTGATATCAAGCCAAATCTCGAGATTTGGCTTGATATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-3664s1c1
Sequence:CCGGCGACCTTCCAAGCAATAGCAACTCGAGTTGCTATTGCTTGGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183208
ZMIZ1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MIZ-type containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2119s1c1
Sequence:CCGGCCAAGATGTCAAACCACCTTTCTCGAGAAAGGTGGTTTGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183208.2-4638s1c1
Sequence:CCGGGCTCTGAAGGAAAGGAACATTCTCGAGAATGTTCCTTTCCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2118s1c1
Sequence:CCGGGCCAAGATGTCAAACCACCTTCTCGAGAAGGTGGTTTGACATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-2141s1c1
Sequence:CCGGCCACCTGATATCAAGCCAAATCTCGAGATTTGGCTTGATATCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183208.2-3664s1c1
Sequence:CCGGCGACCTTCCAAGCAATAGCAACTCGAGTTGCTATTGCTTGGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks