EMAIL THIS PAGE TO A FRIEND

ZMIZ2

zinc finger, MIZ-type containing 2

Synonyms: NET27 TRAFIP20 ZIMP7 hZIMP7
Gene ID:
Human(83637) Summary: ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]
Mouse(52915) zinc finger, MIZ-type containing 2
Rat(289783) zinc finger, MIZ-type containing 2
cow(537266) zinc finger, MIZ-type containing 2
sheep(101115116) zinc finger, MIZ-type containing 2
domestic guinea pig(100722880) zinc finger, MIZ-type containing 2
naked mole-rat(101714443) zinc finger, MIZ-type containing 2
Domestic Rabbit(100337806) zinc finger, MIZ-type containing 2
Zebrafish(100333571) zinc finger, MIZ-type containing 2
Horse(100051958) zinc finger, MIZ-type containing 2
domestic cat(101096797) zinc finger, MIZ-type containing 2
dog(608293) zinc finger, MIZ-type containing 2
chicken(426210) zinc finger, MIZ-type containing 2
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_374430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031449 Rosetta Predictions human pricing
NM_174929 Rosetta Predictions human pricing
XM_001068437 Rosetta Predictions rat pricing
XM_001071255 Rosetta Predictions rat pricing
XM_001071290 Rosetta Predictions rat pricing
XM_001071326 Rosetta Predictions rat pricing
XM_214087 Rosetta Predictions rat pricing
NM_001005867 Rosetta Predictions mouse pricing
NM_028601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358862 predicted 3369
2 SASI_Hs01_00152419 predicted 1647
3 SASI_Hs01_00152420 predicted 2667
4 SASI_Hs01_00152421 predicted 1896
5 SASI_Hs01_00152422 predicted 1980
6 SASI_Hs01_00152423 predicted 2766
7 SASI_Hs01_00152424 predicted 2788
8 SASI_Hs01_00152425 predicted 1591
9 SASI_Hs01_00152426 predicted 1948
10 SASI_Hs01_00152427 predicted 1487
11 SASI_Hs01_00152428 predicted 3263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368854 predicted 3231
2 SASI_Hs01_00125544 predicted 1504
3 SASI_Hs01_00125545 predicted 2532
4 SASI_Hs01_00125546 predicted 1754
5 SASI_Hs01_00125547 predicted 1838
6 SASI_Hs01_00125548 predicted 2627
7 SASI_Hs01_00125549 predicted 2647
8 SASI_Hs01_00125550 predicted 1446
9 SASI_Hs01_00125551 predicted 1809
10 SASI_Hs01_00125552 predicted 1347
11 SASI_Hs01_00125553 predicted 3126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324527 predicted 991
2 SASI_Rn02_00324528 predicted 337
3 SASI_Rn02_00324529 predicted 2749
4 SASI_Rn02_00324530 predicted 1957
5 SASI_Rn02_00324531 predicted 538
6 SASI_Rn02_00324532 predicted 1961
7 SASI_Rn02_00324533 predicted 2853
8 SASI_Rn02_00324534 predicted 997
9 SASI_Rn02_00324535 predicted 897
10 SASI_Rn02_00324536 predicted 3040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334377 predicted 1440
2 SASI_Rn02_00334378 predicted 680
3 SASI_Rn02_00334379 predicted 3110
4 SASI_Rn02_00334380 predicted 2322
5 SASI_Rn02_00334381 predicted 979
6 SASI_Rn02_00334382 predicted 3214
7 SASI_Rn02_00334383 predicted 1343
8 SASI_Rn02_00334384 predicted 3223
9 SASI_Rn02_00334385 predicted 3407
10 SASI_Rn02_00334386 predicted 3265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334540 predicted 999
2 SASI_Rn02_00334541 predicted 335
3 SASI_Rn02_00334542 predicted 2754
4 SASI_Rn02_00334543 predicted 1964
5 SASI_Rn02_00334544 predicted 540
6 SASI_Rn02_00334545 predicted 1960
7 SASI_Rn02_00334546 predicted 2856
8 SASI_Rn02_00334547 predicted 999
9 SASI_Rn02_00334548 predicted 904
10 SASI_Rn02_00334549 predicted 3047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334677 predicted 1436
2 SASI_Rn02_00334678 predicted 2678
3 SASI_Rn02_00334679 predicted 675
4 SASI_Rn02_00334680 predicted 3195
5 SASI_Rn02_00334681 predicted 2402
6 SASI_Rn02_00334682 predicted 977
7 SASI_Rn02_00334683 predicted 3298
8 SASI_Rn02_00334684 predicted 1337
9 SASI_Rn02_00334685 predicted 3303
10 SASI_Rn02_00334686 predicted 3487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159840 predicted 1180
2 SASI_Rn02_00375129 predicted 2425
3 SASI_Rn01_00159841 predicted 427
4 SASI_Rn01_00159842 predicted 2940
5 SASI_Rn01_00159843 predicted 2145
6 SASI_Rn01_00159844 predicted 724
7 SASI_Rn01_00159845 predicted 3036
8 SASI_Rn01_00159847 predicted 1083
9 SASI_Rn02_00375130 predicted 3045
10 SASI_Rn01_00159848 predicted 3226
11 SASI_Rn01_00159846 predicted 3009
12 SASI_Rn01_00159849 predicted 2713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156623 predicted 2110
2 SASI_Mm02_00286688 predicted 1610
3 SASI_Mm01_00156624 predicted 1993
4 SASI_Mm01_00156625 predicted 1802
5 SASI_Mm01_00156626 predicted 2797
6 SASI_Mm01_00156627 predicted 1898
7 SASI_Mm01_00156628 predicted 2173
8 SASI_Mm01_00156629 predicted 839
9 SASI_Mm01_00156630 predicted 1527
10 SASI_Mm01_00156631 predicted 2401
11 SASI_Mm01_00156632 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128698 predicted 2353
2 SASI_Mm02_00334083 predicted 1860
3 SASI_Mm01_00128699 predicted 2238
4 SASI_Mm01_00128700 predicted 2050
5 SASI_Mm01_00128701 predicted 3052
6 SASI_Mm01_00128702 predicted 2145
7 SASI_Mm01_00128703 predicted 2418
8 SASI_Mm01_00128704 predicted 1086
9 SASI_Mm01_00128705 predicted 1778
10 SASI_Mm01_00128706 predicted 2646
11 SASI_Mm01_00128707 predicted 3018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174929
VALIDATED
ZMIZ2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1822s21c1
Sequence:CCGGGTCATGACTGTCGCCACATACCTCGAGGTATGTGGCGACAGTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-2694s21c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174929.2-110s21c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-3121s21c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1035s21c1
Sequence:CCGGCCCACGGGACTGCATTATAAGCTCGAGCTTATAATGCAGTCCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174929
VALIDATED
ZMIZ2 MISSION shRNA shRNA Plasmid DNA
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1822s21c1
Sequence:CCGGGTCATGACTGTCGCCACATACCTCGAGGTATGTGGCGACAGTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-2694s21c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174929.2-110s21c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-3121s21c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1035s21c1
Sequence:CCGGCCCACGGGACTGCATTATAAGCTCGAGCTTATAATGCAGTCCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174929
VALIDATED
ZMIZ2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1822s21c1
Sequence:CCGGGTCATGACTGTCGCCACATACCTCGAGGTATGTGGCGACAGTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-2694s21c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174929.2-110s21c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-3121s21c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_174929.2-1035s21c1
Sequence:CCGGCCCACGGGACTGCATTATAAGCTCGAGCTTATAATGCAGTCCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005867
ZMIZ2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MIZ-type containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005867.1-3245s1c1
Sequence:CCGGCCAGCACTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-547s1c1
Sequence:CCGGCCCTCAACTGACTTCACACAACTCGAGTTGTGTGAAGTCAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-268s1c1
Sequence:CCGGCCACACGGTGATGGTTCATTTCTCGAGAAATGAACCATCACCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-1824s1c1
Sequence:CCGGCACCAAGATAAAGCGGAACTTCTCGAGAAGTTCCGCTTTATCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-2868s1c1
Sequence:CCGGGCTCTCACTCTTCGAGAACAACTCGAGTTGTTCTCGAAGAGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005867
ZMIZ2 MISSION shRNA shRNA Plasmid DNA
zinc finger, MIZ-type containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005867.1-3245s1c1
Sequence:CCGGCCAGCACTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-547s1c1
Sequence:CCGGCCCTCAACTGACTTCACACAACTCGAGTTGTGTGAAGTCAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-268s1c1
Sequence:CCGGCCACACGGTGATGGTTCATTTCTCGAGAAATGAACCATCACCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-1824s1c1
Sequence:CCGGCACCAAGATAAAGCGGAACTTCTCGAGAAGTTCCGCTTTATCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-2868s1c1
Sequence:CCGGGCTCTCACTCTTCGAGAACAACTCGAGTTGTTCTCGAAGAGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005867
ZMIZ2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MIZ-type containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005867.1-3245s1c1
Sequence:CCGGCCAGCACTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-547s1c1
Sequence:CCGGCCCTCAACTGACTTCACACAACTCGAGTTGTGTGAAGTCAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-268s1c1
Sequence:CCGGCCACACGGTGATGGTTCATTTCTCGAGAAATGAACCATCACCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-1824s1c1
Sequence:CCGGCACCAAGATAAAGCGGAACTTCTCGAGAAGTTCCGCTTTATCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005867.1-2868s1c1
Sequence:CCGGGCTCTCACTCTTCGAGAACAACTCGAGTTGTTCTCGAAGAGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374430
VALIDATED
ZMIZ2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-3260s1c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-2833s1c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1815s1c1
Sequence:CCGGCATCACCAAGATAAAGCGGAACTCGAGTTCCGCTTTATCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-171s1c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1485s1c1
Sequence:CCGGAGTCTACAAGACCCTGATAATCTCGAGATTATCAGGGTCTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374430
VALIDATED
ZMIZ2 MISSION shRNA shRNA Plasmid DNA
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-3260s1c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-2833s1c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1815s1c1
Sequence:CCGGCATCACCAAGATAAAGCGGAACTCGAGTTCCGCTTTATCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-171s1c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1485s1c1
Sequence:CCGGAGTCTACAAGACCCTGATAATCTCGAGATTATCAGGGTCTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374430
VALIDATED
ZMIZ2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MIZ-type containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-3260s1c1
Sequence:CCGGCCAGCATTGATCCTTCTGTTTCTCGAGAAACAGAAGGATCAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-2833s1c1
Sequence:CCGGGACCTCCCTACGAACAACAATCTCGAGATTGTTGTTCGTAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1815s1c1
Sequence:CCGGCATCACCAAGATAAAGCGGAACTCGAGTTCCGCTTTATCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-171s1c1
Sequence:CCGGCGGTGATGGTTCATTCGCATACTCGAGTATGCGAATGAACCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_374430.1-1485s1c1
Sequence:CCGGAGTCTACAAGACCCTGATAATCTCGAGATTATCAGGGTCTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks