EMAIL THIS PAGE TO A FRIEND

ZMPSTE24

zinc metallopeptidase STE24

Synonyms: FACE-1 FACE1 HGPS PRO1 STE24 Ste24p
UniProtKB ID: O75844, B3KQI7, D3DPU7, Q8NDZ8, Q9UBQ2
Gene ID:
Human(10269) Summary: This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
Mouse(230709) zinc metallopeptidase, STE24
Rat(313564) zinc metallopeptidase STE24
Zebrafish(334380) zinc metallopeptidase, STE24 homolog
dog(482460) zinc metallopeptidase STE24 homolog (S. cerevisiae)
Horse(100053993) zinc metallopeptidase STE24 homolog (S. cerevisiae)
domestic cat(101098069) zinc metallopeptidase STE24 homolog (S. cerevisiae)
chicken(419572) zinc metallopeptidase STE24
Domestic Rabbit(100339077) zinc metallopeptidase STE24 homolog (S. cerevisiae)
naked mole-rat(101719964) zinc metallopeptidase STE24
domestic guinea pig(100720833) zinc metallopeptidase STE24
cow(538104) zinc metallopeptidase (STE24 homolog, S. cerevisiae)
sheep(101122230) zinc metallopeptidase STE24 homolog (S. cerevisiae)
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005857 siRNAs that have been validated in the lab human pricing
NM_001107974 Rosetta Predictions rat pricing
NM_172700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005857 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158435 validated 751
1 SASI_Hs01_00158434 validated 504
1 SASI_Hs01_00158436 validated 376
2 SASI_Hs01_00158437 predicted 1042
3 SASI_Hs01_00158438 predicted 684
4 SASI_Hs01_00158439 predicted 486
5 SASI_Hs01_00158440 predicted 960
6 SASI_Hs01_00158441 predicted 398
7 SASI_Hs01_00158442 predicted 975
8 SASI_Hs01_00158443 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234125 predicted 1688
2 SASI_Rn02_00234126 predicted 1840
3 SASI_Rn02_00234127 predicted 663
4 SASI_Rn02_00234128 predicted 1241
5 SASI_Rn02_00234129 predicted 1608
6 SASI_Rn02_00234130 predicted 484
7 SASI_Rn02_00234131 predicted 1150
8 SASI_Rn02_00234132 predicted 515
9 SASI_Rn02_00234133 predicted 741
10 SASI_Rn02_00234134 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071445 predicted 1078
2 SASI_Mm01_00071446 predicted 1297
3 SASI_Mm02_00344451 predicted 1480
4 SASI_Mm01_00071447 predicted 588
5 SASI_Mm01_00071448 predicted 1257
6 SASI_Mm01_00071449 predicted 989
7 SASI_Mm01_00071450 predicted 873
8 SASI_Mm01_00071451 predicted 1387
9 SASI_Mm01_00071452 predicted 1139
10 SASI_Mm02_00344452 predicted 1097
11 SASI_Mm01_00071443 predicted 448
12 SASI_Mm01_00071444 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005857
VALIDATED
ZMPSTE24 MISSION shRNA Bacterial Glycerol Stock
zinc metallopeptidase STE24
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-367s1c1
Sequence:CCGGCGACTCTATCAACTGGATAAACTCGAGTTTATCCAGTTGATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-903s1c1
Sequence:CCGGCTTTCCTTTGACGAAGGTGTACTCGAGTACACCTTCGTCAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1500s1c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1355s1c1
Sequence:CCGGCACCTTACAATGAGGTTCTTTCTCGAGAAAGAACCTCATTGTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-336s1c1
Sequence:CCGGGATCATGGATTCTGAAACATTCTCGAGAATGTTTCAGAATCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1546s21c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-846s21c1
Sequence:CCGGTCACAATCTATGCTGATTATACTCGAGTATAATCAGCATAGATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-2130s21c1
Sequence:CCGGTGGTAAGGCCAATGTTATTTACTCGAGTAAATAACATTGGCCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1357s21c1
Sequence:CCGGACCCACTCTTATTGGACTATTCTCGAGAATAGTCCAATAAGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-326s21c1
Sequence:CCGGCAGCGGCAGAGAAGGATATATCTCGAGATATATCCTTCTCTGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005857
VALIDATED
ZMPSTE24 MISSION shRNA shRNA Plasmid DNA
zinc metallopeptidase STE24
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-367s1c1
Sequence:CCGGCGACTCTATCAACTGGATAAACTCGAGTTTATCCAGTTGATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-903s1c1
Sequence:CCGGCTTTCCTTTGACGAAGGTGTACTCGAGTACACCTTCGTCAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1500s1c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1355s1c1
Sequence:CCGGCACCTTACAATGAGGTTCTTTCTCGAGAAAGAACCTCATTGTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-336s1c1
Sequence:CCGGGATCATGGATTCTGAAACATTCTCGAGAATGTTTCAGAATCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1546s21c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-846s21c1
Sequence:CCGGTCACAATCTATGCTGATTATACTCGAGTATAATCAGCATAGATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-2130s21c1
Sequence:CCGGTGGTAAGGCCAATGTTATTTACTCGAGTAAATAACATTGGCCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1357s21c1
Sequence:CCGGACCCACTCTTATTGGACTATTCTCGAGAATAGTCCAATAAGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-326s21c1
Sequence:CCGGCAGCGGCAGAGAAGGATATATCTCGAGATATATCCTTCTCTGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005857
VALIDATED
ZMPSTE24 MISSION shRNA Lentiviral Transduction Particles
zinc metallopeptidase STE24
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-367s1c1
Sequence:CCGGCGACTCTATCAACTGGATAAACTCGAGTTTATCCAGTTGATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005857.2-903s1c1
Sequence:CCGGCTTTCCTTTGACGAAGGTGTACTCGAGTACACCTTCGTCAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1500s1c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-1355s1c1
Sequence:CCGGCACCTTACAATGAGGTTCTTTCTCGAGAAAGAACCTCATTGTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005857.2-336s1c1
Sequence:CCGGGATCATGGATTCTGAAACATTCTCGAGAATGTTTCAGAATCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1546s21c1
Sequence:CCGGCCCTGTTTCTGACTGGTTGTTCTCGAGAACAACCAGTCAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-846s21c1
Sequence:CCGGTCACAATCTATGCTGATTATACTCGAGTATAATCAGCATAGATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-2130s21c1
Sequence:CCGGTGGTAAGGCCAATGTTATTTACTCGAGTAAATAACATTGGCCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005857.3-1357s21c1
Sequence:CCGGACCCACTCTTATTGGACTATTCTCGAGAATAGTCCAATAAGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005857.3-326s21c1
Sequence:CCGGCAGCGGCAGAGAAGGATATATCTCGAGATATATCCTTCTCTGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172700
VALIDATED
ZMPSTE24 MISSION shRNA Bacterial Glycerol Stock
zinc metallopeptidase STE24
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-842s1c1
Sequence:CCGGGCCTGGCTGTTCACATTAGTTCTCGAGAACTAATGTGAACAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1509s1c1
Sequence:CCGGCCAAGAAACTTGGGAAGGCTACTCGAGTAGCCTTCCCAAGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-446s1c1
Sequence:CCGGCGATTGTATCAACTGGATAAACTCGAGTTTATCCAGTTGATACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1580s1c1
Sequence:CCGGCCGGTTTCTGACTGGTTGTTTCTCGAGAAACAACCAGTCAGAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172700.1-361s1c1
Sequence:CCGGGCGGCAGAGAAGGATATACAACTCGAGTTGTATATCCTTCTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-2091s21c1
Sequence:CCGGTTACCTACGTGTTGTTATAATCTCGAGATTATAACAACACGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1466s21c1
Sequence:CCGGACAGTCCTGAGCCGCAGATTTCTCGAGAAATCTGCGGCTCAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1691s21c1
Sequence:CCGGCTGGATGCTCTTCCGGTTATTCTCGAGAATAACCGGAAGAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-881s21c1
Sequence:CCGGACCATTTATGCTGACTATATTCTCGAGAATATAGTCAGCATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172700.2-1001s21c1
Sequence:CCGGTATGTTGTTGAAGGATCTAAGCTCGAGCTTAGATCCTTCAACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-588s21c1
Sequence:CCGGGACCAGAATACGAGATCATTCCTCGAGGAATGATCTCGTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172700
VALIDATED
ZMPSTE24 MISSION shRNA shRNA Plasmid DNA
zinc metallopeptidase STE24
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-842s1c1
Sequence:CCGGGCCTGGCTGTTCACATTAGTTCTCGAGAACTAATGTGAACAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1509s1c1
Sequence:CCGGCCAAGAAACTTGGGAAGGCTACTCGAGTAGCCTTCCCAAGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-446s1c1
Sequence:CCGGCGATTGTATCAACTGGATAAACTCGAGTTTATCCAGTTGATACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1580s1c1
Sequence:CCGGCCGGTTTCTGACTGGTTGTTTCTCGAGAAACAACCAGTCAGAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172700.1-361s1c1
Sequence:CCGGGCGGCAGAGAAGGATATACAACTCGAGTTGTATATCCTTCTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-2091s21c1
Sequence:CCGGTTACCTACGTGTTGTTATAATCTCGAGATTATAACAACACGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1466s21c1
Sequence:CCGGACAGTCCTGAGCCGCAGATTTCTCGAGAAATCTGCGGCTCAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1691s21c1
Sequence:CCGGCTGGATGCTCTTCCGGTTATTCTCGAGAATAACCGGAAGAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-881s21c1
Sequence:CCGGACCATTTATGCTGACTATATTCTCGAGAATATAGTCAGCATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172700.2-1001s21c1
Sequence:CCGGTATGTTGTTGAAGGATCTAAGCTCGAGCTTAGATCCTTCAACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-588s21c1
Sequence:CCGGGACCAGAATACGAGATCATTCCTCGAGGAATGATCTCGTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172700
VALIDATED
ZMPSTE24 MISSION shRNA Lentiviral Transduction Particles
zinc metallopeptidase STE24
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-842s1c1
Sequence:CCGGGCCTGGCTGTTCACATTAGTTCTCGAGAACTAATGTGAACAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1509s1c1
Sequence:CCGGCCAAGAAACTTGGGAAGGCTACTCGAGTAGCCTTCCCAAGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-446s1c1
Sequence:CCGGCGATTGTATCAACTGGATAAACTCGAGTTTATCCAGTTGATACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172700.1-1580s1c1
Sequence:CCGGCCGGTTTCTGACTGGTTGTTTCTCGAGAAACAACCAGTCAGAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172700.1-361s1c1
Sequence:CCGGGCGGCAGAGAAGGATATACAACTCGAGTTGTATATCCTTCTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-2091s21c1
Sequence:CCGGTTACCTACGTGTTGTTATAATCTCGAGATTATAACAACACGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1466s21c1
Sequence:CCGGACAGTCCTGAGCCGCAGATTTCTCGAGAAATCTGCGGCTCAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-1691s21c1
Sequence:CCGGCTGGATGCTCTTCCGGTTATTCTCGAGAATAACCGGAAGAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-881s21c1
Sequence:CCGGACCATTTATGCTGACTATATTCTCGAGAATATAGTCAGCATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172700.2-1001s21c1
Sequence:CCGGTATGTTGTTGAAGGATCTAAGCTCGAGCTTAGATCCTTCAACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172700.2-588s21c1
Sequence:CCGGGACCAGAATACGAGATCATTCCTCGAGGAATGATCTCGTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks