EMAIL THIS PAGE TO A FRIEND

ZMYM1

zinc finger, MYM-type 1

Synonyms: MYM RP11-181E22.4
UniProtKB ID: Q5SVZ6, D3DPR7, Q7Z3Q4
Gene ID:
Mouse(68310) zinc finger, MYM domain containing 1
Rat(313604) zinc finger, MYM-type 1
cow(527379) zinc finger, MYM-type 1
sheep(101108698) zinc finger, MYM-type 1
domestic guinea pig(100722450) zinc finger, MYM-type 1
naked mole-rat(101709021) zinc finger, MYM-type 1
Domestic Rabbit(100349536) zinc finger, MYM-type 1
dog(608768) zinc finger, MYM-type 1
Horse(100069642) zinc finger, MYM-type 1
domestic cat(101085056) zinc finger, MYM-type 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024772 Rosetta Predictions human pricing
NM_001107983 Rosetta Predictions rat pricing
NM_026670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143280 predicted 1159
2 SASI_Hs01_00143283 predicted 1387
3 SASI_Hs01_00143284 predicted 2249
4 SASI_Hs01_00143285 predicted 728
5 SASI_Hs01_00143286 predicted 777
6 SASI_Hs02_00357283 predicted 1282
7 SASI_Hs01_00143287 predicted 2350
8 SASI_Hs02_00357284 predicted 1064
9 SASI_Hs02_00357285 predicted 3231
10 SASI_Hs01_00143288 predicted 2051
11 SASI_Hs01_00143281 predicted 1276
12 SASI_Hs01_00143282 predicted 715
13 SASI_Hs01_00143289 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234205 predicted 1724
2 SASI_Rn02_00234206 predicted 931
3 SASI_Rn02_00234207 predicted 1638
4 SASI_Rn02_00234208 predicted 1153
5 SASI_Rn02_00234209 predicted 646
6 SASI_Rn02_00234210 predicted 1201
7 SASI_Rn02_00234211 predicted 1971
8 SASI_Rn02_00234212 predicted 2805
9 SASI_Rn02_00234213 predicted 1556
10 SASI_Rn02_00234214 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137294 predicted 1704
2 SASI_Mm01_00137295 predicted 2220
3 SASI_Mm02_00330671 predicted 1393
4 SASI_Mm01_00137296 predicted 2852
5 SASI_Mm01_00137297 predicted 2024
6 SASI_Mm02_00330672 predicted 3070
7 SASI_Mm01_00137298 predicted 1997
8 SASI_Mm01_00137300 predicted 1433
9 SASI_Mm01_00137301 predicted 2955
10 SASI_Mm02_00330673 predicted 445
11 SASI_Mm01_00137299 predicted 1648
12 SASI_Mm01_00137302 predicted 1468
13 SASI_Mm01_00137303 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024772
VALIDATED
ZMYM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-1749s21c1
Sequence:CCGGGAGCTGTCAGTGACGATTTATCTCGAGATAAATCGTCACTGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-2674s21c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3857s21c1
Sequence:CCGGTCTTGATTCTTGGTCTATAATCTCGAGATTATAGACCAAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024772.3-2293s21c1
Sequence:CCGGCTATGATAGCACCACTAATTTCTCGAGAAATTAGTGGTGCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3055s21c1
Sequence:CCGGCCAAGGATTAGATACTATATTCTCGAGAATATAGTATCTAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2708s1c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1673s1c1
Sequence:CCGGCCACGGAACTTCTAATTGGAACTCGAGTTCCAATTAGAAGTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2285s1c1
Sequence:CCGGGCAGCAAATTGGAGTTGATATCTCGAGATATCAACTCCAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2622s1c1
Sequence:CCGGCGTACATTACTATCTGTGATTCTCGAGAATCACAGATAGTAATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1311s1c1
Sequence:CCGGGCAGATGTCATTGTGGATCTTCTCGAGAAGATCCACAATGACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024772
VALIDATED
ZMYM1 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-1749s21c1
Sequence:CCGGGAGCTGTCAGTGACGATTTATCTCGAGATAAATCGTCACTGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-2674s21c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3857s21c1
Sequence:CCGGTCTTGATTCTTGGTCTATAATCTCGAGATTATAGACCAAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024772.3-2293s21c1
Sequence:CCGGCTATGATAGCACCACTAATTTCTCGAGAAATTAGTGGTGCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3055s21c1
Sequence:CCGGCCAAGGATTAGATACTATATTCTCGAGAATATAGTATCTAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2708s1c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1673s1c1
Sequence:CCGGCCACGGAACTTCTAATTGGAACTCGAGTTCCAATTAGAAGTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2285s1c1
Sequence:CCGGGCAGCAAATTGGAGTTGATATCTCGAGATATCAACTCCAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2622s1c1
Sequence:CCGGCGTACATTACTATCTGTGATTCTCGAGAATCACAGATAGTAATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1311s1c1
Sequence:CCGGGCAGATGTCATTGTGGATCTTCTCGAGAAGATCCACAATGACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024772
VALIDATED
ZMYM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-1749s21c1
Sequence:CCGGGAGCTGTCAGTGACGATTTATCTCGAGATAAATCGTCACTGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-2674s21c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3857s21c1
Sequence:CCGGTCTTGATTCTTGGTCTATAATCTCGAGATTATAGACCAAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024772.3-2293s21c1
Sequence:CCGGCTATGATAGCACCACTAATTTCTCGAGAAATTAGTGGTGCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024772.3-3055s21c1
Sequence:CCGGCCAAGGATTAGATACTATATTCTCGAGAATATAGTATCTAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2708s1c1
Sequence:CCGGCGCCGATGAATTGAGTCATTTCTCGAGAAATGACTCAATTCATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1673s1c1
Sequence:CCGGCCACGGAACTTCTAATTGGAACTCGAGTTCCAATTAGAAGTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2285s1c1
Sequence:CCGGGCAGCAAATTGGAGTTGATATCTCGAGATATCAACTCCAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-2622s1c1
Sequence:CCGGCGTACATTACTATCTGTGATTCTCGAGAATCACAGATAGTAATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024772.2-1311s1c1
Sequence:CCGGGCAGATGTCATTGTGGATCTTCTCGAGAAGATCCACAATGACATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026670
ZMYM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-3195s21c1
Sequence:CCGGGTTGAGCAGGAACTGGTAAATCTCGAGATTTACCAGTTCCTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-2765s21c1
Sequence:CCGGAGGTCTGGACACGGTATTAAACTCGAGTTTAATACCGTGTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026670.4-3292s21c1
Sequence:CCGGTTGCAACTTTGAGCTTAATTACTCGAGTAATTAAGCTCAAAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-676s21c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-600s21c1
Sequence:CCGGCAATCTTGTCTTACATCATATCTCGAGATATGATGTAAGACAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026670.3-3524s1c1
Sequence:CCGGGCAACTACTATATGCCAGATACTCGAGTATCTGGCATATAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1465s1c1
Sequence:CCGGCGTGTGACAATTCATCTGTTTCTCGAGAAACAGATGAATTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-676s1c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1999s1c1
Sequence:CCGGCCTATGATAGTGCCACAAATTCTCGAGAATTTGTGGCACTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1412s1c1
Sequence:CCGGGCACTTAAAGTCACTGCAATTCTCGAGAATTGCAGTGACTTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026670
ZMYM1 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-3195s21c1
Sequence:CCGGGTTGAGCAGGAACTGGTAAATCTCGAGATTTACCAGTTCCTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-2765s21c1
Sequence:CCGGAGGTCTGGACACGGTATTAAACTCGAGTTTAATACCGTGTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026670.4-3292s21c1
Sequence:CCGGTTGCAACTTTGAGCTTAATTACTCGAGTAATTAAGCTCAAAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-676s21c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-600s21c1
Sequence:CCGGCAATCTTGTCTTACATCATATCTCGAGATATGATGTAAGACAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026670.3-3524s1c1
Sequence:CCGGGCAACTACTATATGCCAGATACTCGAGTATCTGGCATATAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1465s1c1
Sequence:CCGGCGTGTGACAATTCATCTGTTTCTCGAGAAACAGATGAATTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-676s1c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1999s1c1
Sequence:CCGGCCTATGATAGTGCCACAAATTCTCGAGAATTTGTGGCACTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1412s1c1
Sequence:CCGGGCACTTAAAGTCACTGCAATTCTCGAGAATTGCAGTGACTTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026670
ZMYM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-3195s21c1
Sequence:CCGGGTTGAGCAGGAACTGGTAAATCTCGAGATTTACCAGTTCCTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-2765s21c1
Sequence:CCGGAGGTCTGGACACGGTATTAAACTCGAGTTTAATACCGTGTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026670.4-3292s21c1
Sequence:CCGGTTGCAACTTTGAGCTTAATTACTCGAGTAATTAAGCTCAAAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-676s21c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026670.4-600s21c1
Sequence:CCGGCAATCTTGTCTTACATCATATCTCGAGATATGATGTAAGACAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026670.3-3524s1c1
Sequence:CCGGGCAACTACTATATGCCAGATACTCGAGTATCTGGCATATAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1465s1c1
Sequence:CCGGCGTGTGACAATTCATCTGTTTCTCGAGAAACAGATGAATTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-676s1c1
Sequence:CCGGGCAGCATGTGTCAGAAGACATCTCGAGATGTCTTCTGACACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1999s1c1
Sequence:CCGGCCTATGATAGTGCCACAAATTCTCGAGAATTTGTGGCACTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026670.3-1412s1c1
Sequence:CCGGGCACTTAAAGTCACTGCAATTCTCGAGAATTGCAGTGACTTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks