EMAIL THIS PAGE TO A FRIEND

ZMYM2

zinc finger, MYM-type 2

Synonyms: FIM MYM RAMP SCLL ZNF198
Gene ID:
Human(7750) Summary: The protein encoded by this gene is a zinc finger protein that may act as a transcription factor. The encoded protein may be part of a BHC histone deacetylase complex. Translocation of this gene with the fibroblast growth factor receptor-1 gene (FGFR1) results in a fusion gene, which may be a cause of stem cell leukemia lymphoma syndrome (SCLL). Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(76007) zinc finger, MYM-type 2
Rat(305913) zinc finger, MYM-type 2
Zebrafish(570149) zinc finger, MYM-type 2
chicken(418954) zinc finger, MYM-type 2
domestic cat(101082286) zinc finger, MYM-type 2
dog(477346) zinc finger, MYM-type 2
Domestic Rabbit(100345074) zinc finger, MYM-type 2
naked mole-rat(101711817) zinc finger, MYM-type 2
domestic guinea pig(100723763) zinc finger, MYM-type 2
cow(508731) zinc finger, MYM-type 2
sheep(101118795) zinc finger, MYM-type 2
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003453 Rosetta Predictions human pricing
NM_197968 Rosetta Predictions human pricing
XM_001060431 Rosetta Predictions rat pricing
XM_224241 Rosetta Predictions rat pricing
NM_029498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131939 predicted 2475
2 SASI_Hs01_00131940 predicted 2619
3 SASI_Hs02_00335687 predicted 3191
4 SASI_Hs02_00335688 predicted 4357
5 SASI_Hs01_00131942 predicted 2868
6 SASI_Hs02_00335689 predicted 1401
7 SASI_Hs01_00131944 predicted 1259
8 SASI_Hs01_00131945 predicted 627
9 SASI_Hs01_00131946 predicted 3689
10 SASI_Hs01_00131947 predicted 1891
11 SASI_Hs01_00131938 predicted 922
12 SASI_Hs01_00131941 predicted 1544
13 SASI_Hs01_00131943 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033990 predicted 2431
2 SASI_Hs01_00033991 predicted 2577
3 SASI_Hs02_00371580 predicted 3144
4 SASI_Hs02_00371581 predicted 4308
5 SASI_Hs01_00033993 predicted 2826
6 SASI_Hs02_00371582 predicted 1348
7 SASI_Hs01_00033995 predicted 1216
8 SASI_Hs01_00033996 predicted 581
9 SASI_Hs01_00033997 predicted 3634
10 SASI_Hs01_00033998 predicted 1840
11 SASI_Hs01_00033989 predicted 876
12 SASI_Hs01_00033992 predicted 1496
13 SASI_Hs01_00033994 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296494 predicted 4063
2 SASI_Rn02_00296495 predicted 3513
3 SASI_Rn02_00296496 predicted 4217
4 SASI_Rn02_00296497 predicted 1307
5 SASI_Rn02_00296498 predicted 956
6 SASI_Rn02_00296499 predicted 513
7 SASI_Rn02_00296500 predicted 706
8 SASI_Rn02_00296501 predicted 2956
9 SASI_Rn02_00296502 predicted 2637
10 SASI_Rn02_00296503 predicted 2271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381839 predicted 4151
2 SASI_Rn02_00381840 predicted 3593
3 SASI_Rn02_00381841 predicted 4306
4 SASI_Rn02_00381842 predicted 1420
5 SASI_Rn02_00381843 predicted 261
6 SASI_Rn02_00381844 predicted 1769
7 SASI_Rn02_00381845 predicted 1071
8 SASI_Rn02_00381846 predicted 624
9 SASI_Rn02_00381847 predicted 817
10 SASI_Rn02_00381848 predicted 2723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127607 predicted 4066
2 SASI_Mm01_00127608 predicted 399
3 SASI_Mm01_00127609 predicted 4218
4 SASI_Mm01_00127610 predicted 3516
5 SASI_Mm01_00127611 predicted 1310
6 SASI_Mm02_00335436 predicted 1747
7 SASI_Mm01_00127613 predicted 3568
8 SASI_Mm01_00127614 predicted 2756
9 SASI_Mm01_00127615 predicted 1667
10 SASI_Mm01_00127616 predicted 285
11 SASI_Mm01_00127612 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003453
ZMYM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003453.2-4556s1c1
Sequence:CCGGGCTGGGTATTACCATGTAAATCTCGAGATTTACATGGTAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-3735s1c1
Sequence:CCGGGCCTTGGAATACAGGAGTATTCTCGAGAATACTCCTGTATTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2062s1c1
Sequence:CCGGGCGAAACTCTTTACCTCAATACTCGAGTATTGAGGTAAAGAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-916s1c1
Sequence:CCGGCGGGCGAGATATGAACTTAATCTCGAGATTAAGTTCATATCTCGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2191s1c1
Sequence:CCGGGCCAAGTGATATTCAGTTGAACTCGAGTTCAACTGAATATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3652s21c1
Sequence:CCGGTAACTATGGGTTAGCTCATTTCTCGAGAAATGAGCTAACCCATAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3854s21c1
Sequence:CCGGATACTTCCAGATGGGTCAATACTCGAGTATTGACCCATCTGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-2294s21c1
Sequence:CCGGACTTGTTCAGATGACTATAAGCTCGAGCTTATAGTCATCTGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4860s21c1
Sequence:CCGGTTGCAGTGTCTTTCGGAATTTCTCGAGAAATTCCGAAAGACACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4443s21c1
Sequence:CCGGTGCAGAAGCAATCGGGATAAACTCGAGTTTATCCCGATTGCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-420s21c1
Sequence:CCGGCTTTAGTGTCTAGATCTAATACTCGAGTATTAGATCTAGACACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003453
ZMYM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003453.2-4556s1c1
Sequence:CCGGGCTGGGTATTACCATGTAAATCTCGAGATTTACATGGTAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-3735s1c1
Sequence:CCGGGCCTTGGAATACAGGAGTATTCTCGAGAATACTCCTGTATTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2062s1c1
Sequence:CCGGGCGAAACTCTTTACCTCAATACTCGAGTATTGAGGTAAAGAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-916s1c1
Sequence:CCGGCGGGCGAGATATGAACTTAATCTCGAGATTAAGTTCATATCTCGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2191s1c1
Sequence:CCGGGCCAAGTGATATTCAGTTGAACTCGAGTTCAACTGAATATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3652s21c1
Sequence:CCGGTAACTATGGGTTAGCTCATTTCTCGAGAAATGAGCTAACCCATAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3854s21c1
Sequence:CCGGATACTTCCAGATGGGTCAATACTCGAGTATTGACCCATCTGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-2294s21c1
Sequence:CCGGACTTGTTCAGATGACTATAAGCTCGAGCTTATAGTCATCTGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4860s21c1
Sequence:CCGGTTGCAGTGTCTTTCGGAATTTCTCGAGAAATTCCGAAAGACACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4443s21c1
Sequence:CCGGTGCAGAAGCAATCGGGATAAACTCGAGTTTATCCCGATTGCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-420s21c1
Sequence:CCGGCTTTAGTGTCTAGATCTAATACTCGAGTATTAGATCTAGACACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003453
ZMYM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003453.2-4556s1c1
Sequence:CCGGGCTGGGTATTACCATGTAAATCTCGAGATTTACATGGTAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-3735s1c1
Sequence:CCGGGCCTTGGAATACAGGAGTATTCTCGAGAATACTCCTGTATTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2062s1c1
Sequence:CCGGGCGAAACTCTTTACCTCAATACTCGAGTATTGAGGTAAAGAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-916s1c1
Sequence:CCGGCGGGCGAGATATGAACTTAATCTCGAGATTAAGTTCATATCTCGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003453.2-2191s1c1
Sequence:CCGGGCCAAGTGATATTCAGTTGAACTCGAGTTCAACTGAATATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3652s21c1
Sequence:CCGGTAACTATGGGTTAGCTCATTTCTCGAGAAATGAGCTAACCCATAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-3854s21c1
Sequence:CCGGATACTTCCAGATGGGTCAATACTCGAGTATTGACCCATCTGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-2294s21c1
Sequence:CCGGACTTGTTCAGATGACTATAAGCTCGAGCTTATAGTCATCTGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4860s21c1
Sequence:CCGGTTGCAGTGTCTTTCGGAATTTCTCGAGAAATTCCGAAAGACACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003453.2-4443s21c1
Sequence:CCGGTGCAGAAGCAATCGGGATAAACTCGAGTTTATCCCGATTGCTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003453.2-420s21c1
Sequence:CCGGCTTTAGTGTCTAGATCTAATACTCGAGTATTAGATCTAGACACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029498
VALIDATED
ZMYM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-3303s1c1
Sequence:CCGGGCGTGGAAACATTGGGTCAAACTCGAGTTTGACCCAATGTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-775s1c1
Sequence:CCGGCCAGTAACTTTGGTGTGAATACTCGAGTATTCACACCAAAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-3417s1c1
Sequence:CCGGGCTGAGCTTAACTATGGGTTACTCGAGTAACCCATAGTTAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-1173s1c1
Sequence:CCGGGCTCCAAAGAAACTCTGTGTTCTCGAGAACACAGAGTTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-2098s1c1
Sequence:CCGGGCATAGTTACATATTGCGAATCTCGAGATTCGCAATATGTAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029498
VALIDATED
ZMYM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-3303s1c1
Sequence:CCGGGCGTGGAAACATTGGGTCAAACTCGAGTTTGACCCAATGTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-775s1c1
Sequence:CCGGCCAGTAACTTTGGTGTGAATACTCGAGTATTCACACCAAAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-3417s1c1
Sequence:CCGGGCTGAGCTTAACTATGGGTTACTCGAGTAACCCATAGTTAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-1173s1c1
Sequence:CCGGGCTCCAAAGAAACTCTGTGTTCTCGAGAACACAGAGTTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-2098s1c1
Sequence:CCGGGCATAGTTACATATTGCGAATCTCGAGATTCGCAATATGTAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029498
VALIDATED
ZMYM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-3303s1c1
Sequence:CCGGGCGTGGAAACATTGGGTCAAACTCGAGTTTGACCCAATGTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-775s1c1
Sequence:CCGGCCAGTAACTTTGGTGTGAATACTCGAGTATTCACACCAAAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-3417s1c1
Sequence:CCGGGCTGAGCTTAACTATGGGTTACTCGAGTAACCCATAGTTAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029498.2-1173s1c1
Sequence:CCGGGCTCCAAAGAAACTCTGTGTTCTCGAGAACACAGAGTTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029498.2-2098s1c1
Sequence:CCGGGCATAGTTACATATTGCGAATCTCGAGATTCGCAATATGTAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks