EMAIL THIS PAGE TO A FRIEND

ZMYM3

zinc finger, MYM-type 3

Synonyms: DXS6673E MYM XFIM ZNF198L2 ZNF261
UniProtKB ID: Q14202, D3DVV3, O15089, Q96E26
Gene ID:
Human(9203) Summary: This gene is located on the X chromosome and is subject to X inactivation. It is highly conserved in vertebrates and most abundantly expressed in the brain. The encoded protein is a component of histone deacetylase-containing multiprotein complexes that function through modifying chromatin structure to keep genes silent. A chromosomal translocation (X;13) involving this gene is associated with X-linked mental retardation. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(56364) zinc finger, MYM-type 3
Rat(317260) zinc finger, MYM-type 3
cow(522721) zinc finger, MYM-type 3
sheep(101105305) zinc finger, MYM-type 3
domestic guinea pig(100730190) zinc finger, MYM-type 3
naked mole-rat(101717438) zinc finger, MYM-type 3
Domestic Rabbit(100352799) zinc finger, MYM-type 3
chicken(422209) zinc finger, MYM-type 3
dog(491948) zinc finger, MYM-type 3
domestic cat(101092246) zinc finger, MYM-type 3
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34515 Anti-ZMyM3 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, rabbit, canine, rat, human, bovine, guinea pig, horse
western blot pricing
AV34516 Anti-ZMyM3 (AB2) antibody produced in rabbit IgG fraction of antiserum human, rabbit, mouse, rat, canine, guinea pig, bovine, horse
western blot pricing
HPA003211 Anti-ZMYM3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500617 Anti-ZMYM3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005096 Rosetta Predictions human pricing
NM_201599 Rosetta Predictions human pricing
NM_001040155 Rosetta Predictions rat pricing
XM_001061563 Rosetta Predictions rat pricing
XM_001061618 Rosetta Predictions rat pricing
XM_001081960 Rosetta Predictions rat pricing
NM_019831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065060 predicted 4296
2 SASI_Hs01_00065062 predicted 1948
3 SASI_Hs01_00065063 predicted 3123
4 SASI_Hs01_00065064 predicted 1959
5 SASI_Hs01_00065065 predicted 4230
6 SASI_Hs01_00065066 predicted 1171
7 SASI_Hs01_00065067 predicted 2135
8 SASI_Hs01_00065068 predicted 906
9 SASI_Hs01_00065069 predicted 3152
10 SASI_Hs02_00338973 predicted 3581
11 SASI_Hs01_00065061 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130101 predicted 4274
2 SASI_Hs01_00130103 predicted 1921
3 SASI_Hs01_00130104 predicted 3097
4 SASI_Hs01_00130105 predicted 1934
5 SASI_Hs01_00130106 predicted 4205
6 SASI_Hs01_00130107 predicted 1146
7 SASI_Hs01_00130108 predicted 2108
8 SASI_Hs01_00130109 predicted 874
9 SASI_Hs01_00130110 predicted 3127
10 SASI_Hs02_00373123 predicted 3557
11 SASI_Hs01_00130102 predicted 3028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204895 predicted 2979
2 SASI_Rn02_00204896 predicted 3156
3 SASI_Rn02_00204897 predicted 1195
4 SASI_Rn02_00204898 predicted 1973
5 SASI_Rn02_00204899 predicted 3609
6 SASI_Rn02_00204900 predicted 1218
7 SASI_Rn02_00204901 predicted 3631
8 SASI_Rn02_00204902 predicted 3966
9 SASI_Rn02_00204903 predicted 1662
10 SASI_Rn02_00204904 predicted 3605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300516 predicted 2979
2 SASI_Rn02_00300517 predicted 3164
3 SASI_Rn02_00300518 predicted 1210
4 SASI_Rn02_00300519 predicted 1981
5 SASI_Rn02_00300520 predicted 3614
6 SASI_Rn02_00300521 predicted 1232
7 SASI_Rn02_00300522 predicted 3639
8 SASI_Rn02_00300523 predicted 3977
9 SASI_Rn02_00300524 predicted 1667
10 SASI_Rn02_00300525 predicted 3613
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300715 predicted 3076
2 SASI_Rn02_00300716 predicted 3261
3 SASI_Rn02_00300717 predicted 1298
4 SASI_Rn02_00300718 predicted 2069
5 SASI_Rn02_00300719 predicted 3692
6 SASI_Rn02_00300720 predicted 1325
7 SASI_Rn02_00300721 predicted 3707
8 SASI_Rn02_00300722 predicted 3791
9 SASI_Rn02_00300723 predicted 1762
10 SASI_Rn02_00300724 predicted 3685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374251 predicted 893
2 SASI_Rn02_00374252 predicted 543
3 SASI_Rn02_00374253 predicted 566
4 SASI_Rn02_00374254 predicted 805
5 SASI_Rn02_00374255 predicted 933
6 SASI_Rn02_00374256 predicted 708
7 SASI_Rn02_00374257 predicted 592
8 SASI_Rn02_00374258 predicted 498
9 SASI_Rn02_00374259 predicted 1007
10 SASI_Rn02_00374260 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159140 predicted 3931
2 SASI_Mm01_00159141 predicted 3741
3 SASI_Mm01_00159142 predicted 4700
4 SASI_Mm01_00159143 predicted 4652
5 SASI_Mm01_00159144 predicted 4104
6 SASI_Mm01_00159145 predicted 2552
7 SASI_Mm01_00159146 predicted 1784
8 SASI_Mm01_00159147 predicted 4199
9 SASI_Mm01_00159148 predicted 4212
10 SASI_Mm01_00159149 predicted 4554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005096
VALIDATED
ZMYM3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3285s1c1
Sequence:CCGGGTTGTACCGGGCTCAACTATTCTCGAGAATAGTTGAGCCCGGTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3112s1c1
Sequence:CCGGCCCTAAGAATCCTCTGGACATCTCGAGATGTCCAGAGGATTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-4583s1c1
Sequence:CCGGGCATAGGTAGAGCCTCTTGTTCTCGAGAACAAGAGGCTCTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-2027s1c1
Sequence:CCGGGAGAAACTCTTGCATGAGAAACTCGAGTTTCTCATGCAAGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005096.2-4774s1c1
Sequence:CCGGCCTCCTATGAAATAATTGGTTCTCGAGAACCAATTATTTCATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-1621s1c1
Sequence:CCGGCCTGTGTAAGAACTTTGAGATCTCGAGATCTCAAAGTTCTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-2130s1c1
Sequence:CCGGGCTTGTGCTGTATCACTTGTACTCGAGTACAAGTGATACAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3582s1c1
Sequence:CCGGCGGACCTTTACTACCTGACTTCTCGAGAAGTCAGGTAGTAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-3101s1c1
Sequence:CCGGGAGGCAGACTTCCCTAAGAATCTCGAGATTCTTAGGGAAGTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005096
VALIDATED
ZMYM3 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3285s1c1
Sequence:CCGGGTTGTACCGGGCTCAACTATTCTCGAGAATAGTTGAGCCCGGTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3112s1c1
Sequence:CCGGCCCTAAGAATCCTCTGGACATCTCGAGATGTCCAGAGGATTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-4583s1c1
Sequence:CCGGGCATAGGTAGAGCCTCTTGTTCTCGAGAACAAGAGGCTCTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-2027s1c1
Sequence:CCGGGAGAAACTCTTGCATGAGAAACTCGAGTTTCTCATGCAAGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005096.2-4774s1c1
Sequence:CCGGCCTCCTATGAAATAATTGGTTCTCGAGAACCAATTATTTCATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-1621s1c1
Sequence:CCGGCCTGTGTAAGAACTTTGAGATCTCGAGATCTCAAAGTTCTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-2130s1c1
Sequence:CCGGGCTTGTGCTGTATCACTTGTACTCGAGTACAAGTGATACAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3582s1c1
Sequence:CCGGCGGACCTTTACTACCTGACTTCTCGAGAAGTCAGGTAGTAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-3101s1c1
Sequence:CCGGGAGGCAGACTTCCCTAAGAATCTCGAGATTCTTAGGGAAGTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005096
VALIDATED
ZMYM3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3285s1c1
Sequence:CCGGGTTGTACCGGGCTCAACTATTCTCGAGAATAGTTGAGCCCGGTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3112s1c1
Sequence:CCGGCCCTAAGAATCCTCTGGACATCTCGAGATGTCCAGAGGATTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-4583s1c1
Sequence:CCGGGCATAGGTAGAGCCTCTTGTTCTCGAGAACAAGAGGCTCTACCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-2027s1c1
Sequence:CCGGGAGAAACTCTTGCATGAGAAACTCGAGTTTCTCATGCAAGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005096.2-4774s1c1
Sequence:CCGGCCTCCTATGAAATAATTGGTTCTCGAGAACCAATTATTTCATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-1621s1c1
Sequence:CCGGCCTGTGTAAGAACTTTGAGATCTCGAGATCTCAAAGTTCTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-2130s1c1
Sequence:CCGGGCTTGTGCTGTATCACTTGTACTCGAGTACAAGTGATACAGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005096.2-3582s1c1
Sequence:CCGGCGGACCTTTACTACCTGACTTCTCGAGAAGTCAGGTAGTAAAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005096.2-3101s1c1
Sequence:CCGGGAGGCAGACTTCCCTAAGAATCTCGAGATTCTTAGGGAAGTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019831
ZMYM3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019831.1-5582s1c1
Sequence:CCGGGCCTCCCTTTAGTTCCATGAACTCGAGTTCATGGAACTAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3887s1c1
Sequence:CCGGGCCTAGTTGTACTGGTCTCAACTCGAGTTGAGACCAGTACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-4340s1c1
Sequence:CCGGCCTCCTCAATACCCTCATGTTCTCGAGAACATGAGGGTATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3743s1c1
Sequence:CCGGCCCAAGTGTAGACTTCCTCTTCTCGAGAAGAGGAAGTCTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-2297s1c1
Sequence:CCGGCCTGTGCTGTACCACTTCTTACTCGAGTAAGAAGTGGTACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019831
ZMYM3 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019831.1-5582s1c1
Sequence:CCGGGCCTCCCTTTAGTTCCATGAACTCGAGTTCATGGAACTAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3887s1c1
Sequence:CCGGGCCTAGTTGTACTGGTCTCAACTCGAGTTGAGACCAGTACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-4340s1c1
Sequence:CCGGCCTCCTCAATACCCTCATGTTCTCGAGAACATGAGGGTATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3743s1c1
Sequence:CCGGCCCAAGTGTAGACTTCCTCTTCTCGAGAAGAGGAAGTCTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-2297s1c1
Sequence:CCGGCCTGTGCTGTACCACTTCTTACTCGAGTAAGAAGTGGTACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019831
ZMYM3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019831.1-5582s1c1
Sequence:CCGGGCCTCCCTTTAGTTCCATGAACTCGAGTTCATGGAACTAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3887s1c1
Sequence:CCGGGCCTAGTTGTACTGGTCTCAACTCGAGTTGAGACCAGTACAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-4340s1c1
Sequence:CCGGCCTCCTCAATACCCTCATGTTCTCGAGAACATGAGGGTATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-3743s1c1
Sequence:CCGGCCCAAGTGTAGACTTCCTCTTCTCGAGAAGAGGAAGTCTACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019831.1-2297s1c1
Sequence:CCGGCCTGTGCTGTACCACTTCTTACTCGAGTAAGAAGTGGTACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks