EMAIL THIS PAGE TO A FRIEND

ZMYM4

zinc finger, MYM-type 4

Synonyms: CDIR MYM ZNF198L3 ZNF262
Gene ID:
Mouse(67785) zinc finger, MYM-type 4
Rat(313598) zinc finger, MYM-type 4
Zebrafish(327248) zinc finger, MYM-type 4
Horse(100069550) zinc finger, MYM-type 4
domestic cat(101085483) zinc finger, MYM-type 4
dog(482484) zinc finger, MYM-type 4
chicken(419635) zinc finger, MYM-type 4
Domestic Rabbit(100349284) zinc finger, MYM-type 4
naked mole-rat(101708779) zinc finger, MYM-type 4
domestic guinea pig(100734910) zinc finger, MYM-type 4
cow(529962) zinc finger, MYM-type 4
sheep(101115501) zinc finger, MYM-type 4
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005095 Rosetta Predictions human pricing
NM_001107982 Rosetta Predictions rat pricing
NM_001114399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338969 predicted 1797
2 SASI_Hs01_00214588 predicted 1580
3 SASI_Hs01_00214590 predicted 2591
4 SASI_Hs01_00214591 predicted 3338
5 SASI_Hs01_00214592 predicted 2095
6 SASI_Hs02_00338970 predicted 4116
7 SASI_Hs01_00214593 predicted 4181
8 SASI_Hs02_00338971 predicted 4072
9 SASI_Hs01_00214595 predicted 230
10 SASI_Hs02_00338972 predicted 3367
11 SASI_Hs01_00214589 predicted 4806
12 SASI_Hs01_00214594 predicted 3563
13 SASI_Hs01_00214596 predicted 4329
14 SASI_Hs01_00214597 predicted 3289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234195 predicted 2521
2 SASI_Rn02_00234196 predicted 2809
3 SASI_Rn02_00234197 predicted 3668
4 SASI_Rn02_00234198 predicted 1847
5 SASI_Rn02_00234199 predicted 645
6 SASI_Rn02_00234200 predicted 2363
7 SASI_Rn02_00234201 predicted 2933
8 SASI_Rn02_00234202 predicted 1141
9 SASI_Rn02_00234203 predicted 3667
10 SASI_Rn02_00234204 predicted 3609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308628 predicted 865
2 SASI_Mm02_00308629 predicted 3674
3 SASI_Mm02_00308630 predicted 3331
4 SASI_Mm02_00308631 predicted 1773
5 SASI_Mm02_00308632 predicted 2924
6 SASI_Mm02_00308633 predicted 4171
7 SASI_Mm02_00308634 predicted 4063
8 SASI_Mm02_00308635 predicted 3924
9 SASI_Mm02_00308636 predicted 687
10 SASI_Mm02_00308637 predicted 4112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005095
VALIDATED
ZMYM4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-2427s1c1
Sequence:CCGGCCCAAATTGGTACAGAATAATCTCGAGATTATTCTGTACCAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-249s1c1
Sequence:CCGGCCGAATCAAACAGGATCTGAACTCGAGTTCAGATCCTGTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005095.2-6479s1c1
Sequence:CCGGGCCAATAAACTATCCAGAAATCTCGAGATTTCTGGATAGTTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-3404s1c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005095.2-5193s1c1
Sequence:CCGGCCAGATTTGAAGACCCAATAACTCGAGTTATTGGGTCTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005095.2-732s1c1
Sequence:CCGGCCAGAAACAAACTTTAGGGATCTCGAGATCCCTAAAGTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-2118s1c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2118s21c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005095.2-5194s21c1
Sequence:CCGGCAGATTTGAAGACCCAATAAACTCGAGTTTATTGGGTCTTCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2171s21c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-3985s1c1
Sequence:CCGGATGATCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-2171s1c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-1455s1c1
Sequence:CCGGTACCAGAATGTGGTCCATAAACTCGAGTTTATGGACCACATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005095.2-3404s21c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005095
VALIDATED
ZMYM4 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-2427s1c1
Sequence:CCGGCCCAAATTGGTACAGAATAATCTCGAGATTATTCTGTACCAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-249s1c1
Sequence:CCGGCCGAATCAAACAGGATCTGAACTCGAGTTCAGATCCTGTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005095.2-6479s1c1
Sequence:CCGGGCCAATAAACTATCCAGAAATCTCGAGATTTCTGGATAGTTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-3404s1c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005095.2-5193s1c1
Sequence:CCGGCCAGATTTGAAGACCCAATAACTCGAGTTATTGGGTCTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005095.2-732s1c1
Sequence:CCGGCCAGAAACAAACTTTAGGGATCTCGAGATCCCTAAAGTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-2118s1c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2118s21c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005095.2-5194s21c1
Sequence:CCGGCAGATTTGAAGACCCAATAAACTCGAGTTTATTGGGTCTTCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2171s21c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-3985s1c1
Sequence:CCGGATGATCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-2171s1c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-1455s1c1
Sequence:CCGGTACCAGAATGTGGTCCATAAACTCGAGTTTATGGACCACATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005095.2-3404s21c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005095
VALIDATED
ZMYM4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-2427s1c1
Sequence:CCGGCCCAAATTGGTACAGAATAATCTCGAGATTATTCTGTACCAATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-249s1c1
Sequence:CCGGCCGAATCAAACAGGATCTGAACTCGAGTTCAGATCCTGTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005095.2-6479s1c1
Sequence:CCGGGCCAATAAACTATCCAGAAATCTCGAGATTTCTGGATAGTTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-3404s1c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005095.2-5193s1c1
Sequence:CCGGCCAGATTTGAAGACCCAATAACTCGAGTTATTGGGTCTTCAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005095.2-732s1c1
Sequence:CCGGCCAGAAACAAACTTTAGGGATCTCGAGATCCCTAAAGTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005095.2-2118s1c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2118s21c1
Sequence:CCGGCGAAGTGTTGTGAAACTCAAACTCGAGTTTGAGTTTCACAACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005095.2-5194s21c1
Sequence:CCGGCAGATTTGAAGACCCAATAAACTCGAGTTTATTGGGTCTTCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005095.2-2171s21c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005095.2-3985s1c1
Sequence:CCGGATGATCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-2171s1c1
Sequence:CCGGACCAGAACTTCTTGACTATAACTCGAGTTATAGTCAAGAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005095.2-1455s1c1
Sequence:CCGGTACCAGAATGTGGTCCATAAACTCGAGTTTATGGACCACATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005095.2-3404s21c1
Sequence:CCGGGCTGAATCACTATGCCTTAAACTCGAGTTTAAGGCATAGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114399
VALIDATED
ZMYM4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1324s21c1
Sequence:GTACCGGCAATCATGCTTGTCAACATATCTCGAGATATGTTGACAAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-3396s21c1
Sequence:CCGGGCTGAATCATTACGCATTAAACTCGAGTTTAATGCGTAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114399.1-3977s21c1
Sequence:CCGGATGACCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1443s21c1
Sequence:CCGGTTACCAGAACGTGGTTCATAACTCGAGTTATGAACCACGTTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-5208s21c1
Sequence:CCGGGATAGTGGTCTGGATTGATTTCTCGAGAAATCAATCCAGACCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114399
VALIDATED
ZMYM4 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1324s21c1
Sequence:GTACCGGCAATCATGCTTGTCAACATATCTCGAGATATGTTGACAAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-3396s21c1
Sequence:CCGGGCTGAATCATTACGCATTAAACTCGAGTTTAATGCGTAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114399.1-3977s21c1
Sequence:CCGGATGACCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1443s21c1
Sequence:CCGGTTACCAGAACGTGGTTCATAACTCGAGTTATGAACCACGTTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-5208s21c1
Sequence:CCGGGATAGTGGTCTGGATTGATTTCTCGAGAAATCAATCCAGACCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114399
VALIDATED
ZMYM4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1324s21c1
Sequence:GTACCGGCAATCATGCTTGTCAACATATCTCGAGATATGTTGACAAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-3396s21c1
Sequence:CCGGGCTGAATCATTACGCATTAAACTCGAGTTTAATGCGTAATGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114399.1-3977s21c1
Sequence:CCGGATGACCCAGACAGTATCTTATCTCGAGATAAGATACTGTCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-1443s21c1
Sequence:CCGGTTACCAGAACGTGGTTCATAACTCGAGTTATGAACCACGTTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001114399.1-5208s21c1
Sequence:CCGGGATAGTGGTCTGGATTGATTTCTCGAGAAATCAATCCAGACCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks