EMAIL THIS PAGE TO A FRIEND

ZMYM5

zinc finger, MYM-type 5

Synonyms: HSPC050 MYM ZNF198L1 ZNF237
Gene ID:
Mouse(219105) zinc finger, MYM-type 5
domestic cat(101082032) zinc finger, MYM-type 5
dog(609614) zinc finger, MYM-type 5
cow(536389) zinc finger, MYM-type 5
sheep(101119317) zinc finger, MYM-type 5
domestic guinea pig(100713778) zinc finger, MYM-type 5
naked mole-rat(101713258) zinc finger, MYM-type 5
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014242 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100751 MISSION® esiRNA esiRNA human ZMYM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039649 Rosetta Predictions human pricing
NM_001039650 Rosetta Predictions human pricing
NM_144842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066638 predicted 288
2 SASI_Hs01_00066639 predicted 783
3 SASI_Hs01_00066640 predicted 865
4 SASI_Hs01_00066641 predicted 283
5 SASI_Hs01_00066642 predicted 483
6 SASI_Hs01_00066644 predicted 976
7 SASI_Hs01_00066645 predicted 331
8 SASI_Hs02_00308613 predicted 852
9 SASI_Hs02_00308614 predicted 382
10 SASI_Hs02_00308615 predicted 853
11 SASI_Hs01_00066637 predicted 535
12 SASI_Hs01_00066643 predicted 810
13 SASI_Hs01_00066646 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060829 predicted 1423
2 SASI_Hs01_00060830 predicted 1129
3 SASI_Hs01_00060831 predicted 280
4 SASI_Hs01_00060832 predicted 488
5 SASI_Hs01_00060833 predicted 807
6 SASI_Hs01_00060834 predicted 1136
7 SASI_Hs01_00060835 predicted 1353
8 SASI_Hs01_00060836 predicted 330
9 SASI_Hs01_00060837 predicted 1430
10 SASI_Hs02_00308616 predicted 479
11 SASI_Hs01_00060838 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074922 predicted 1262
2 SASI_Mm02_00340232 predicted 1407
3 SASI_Mm02_00340233 predicted 2226
4 SASI_Mm02_00340234 predicted 2013
5 SASI_Mm02_00340235 predicted 1865
6 SASI_Mm02_00340236 predicted 1769
7 SASI_Mm02_00340237 predicted 1392
8 SASI_Mm01_00074923 predicted 530
9 SASI_Mm02_00340238 predicted 1197
10 SASI_Mm02_00340239 predicted 2208
11 SASI_Mm01_00074924 predicted 385
12 SASI_Mm01_00074925 predicted 627
13 SASI_Mm01_00074926 predicted 1151
14 SASI_Mm01_00074927 predicted 1131
15 SASI_Mm01_00074928 predicted 395
16 SASI_Mm01_00074929 predicted 615
17 SASI_Mm01_00074930 predicted 283
18 SASI_Mm01_00074931 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144842
VALIDATED
ZMYM5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2065s21c1
Sequence:CCGGGCACATCAACAATAGTGTTAACTCGAGTTAACACTATTGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2153s21c1
Sequence:CCGGGTGCAGCTACTGTACACATAACTCGAGTTATGTGTACAGTAGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144842.3-2666s21c1
Sequence:CCGGCAACAGCTGTTTGTTATTAAACTCGAGTTTAATAACAAACAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-419s21c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-1713s21c1
Sequence:CCGGAGGAATTGGATATGTCCATTTCTCGAGAAATGGACATATCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-1255s1c1
Sequence:CCGGGCCAGAATTGTGCTGACGAATCTCGAGATTCGTCAGCACAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-896s1c1
Sequence:CCGGCGTACTCGAAAGACACGGAATCTCGAGATTCCGTGTCTTTCGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-282s1c1
Sequence:CCGGCTCCAGCAATACCTAATGAAACTCGAGTTTCATTAGGTATTGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-281s1c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-608s1c1
Sequence:CCGGGCGTTTCAGAATGGAAGATTTCTCGAGAAATCTTCCATTCTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144842
VALIDATED
ZMYM5 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2065s21c1
Sequence:CCGGGCACATCAACAATAGTGTTAACTCGAGTTAACACTATTGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2153s21c1
Sequence:CCGGGTGCAGCTACTGTACACATAACTCGAGTTATGTGTACAGTAGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144842.3-2666s21c1
Sequence:CCGGCAACAGCTGTTTGTTATTAAACTCGAGTTTAATAACAAACAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-419s21c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-1713s21c1
Sequence:CCGGAGGAATTGGATATGTCCATTTCTCGAGAAATGGACATATCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-1255s1c1
Sequence:CCGGGCCAGAATTGTGCTGACGAATCTCGAGATTCGTCAGCACAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-896s1c1
Sequence:CCGGCGTACTCGAAAGACACGGAATCTCGAGATTCCGTGTCTTTCGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-282s1c1
Sequence:CCGGCTCCAGCAATACCTAATGAAACTCGAGTTTCATTAGGTATTGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-281s1c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-608s1c1
Sequence:CCGGGCGTTTCAGAATGGAAGATTTCTCGAGAAATCTTCCATTCTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144842
VALIDATED
ZMYM5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2065s21c1
Sequence:CCGGGCACATCAACAATAGTGTTAACTCGAGTTAACACTATTGTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-2153s21c1
Sequence:CCGGGTGCAGCTACTGTACACATAACTCGAGTTATGTGTACAGTAGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144842.3-2666s21c1
Sequence:CCGGCAACAGCTGTTTGTTATTAAACTCGAGTTTAATAACAAACAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-419s21c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144842.3-1713s21c1
Sequence:CCGGAGGAATTGGATATGTCCATTTCTCGAGAAATGGACATATCCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-1255s1c1
Sequence:CCGGGCCAGAATTGTGCTGACGAATCTCGAGATTCGTCAGCACAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-896s1c1
Sequence:CCGGCGTACTCGAAAGACACGGAATCTCGAGATTCCGTGTCTTTCGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-282s1c1
Sequence:CCGGCTCCAGCAATACCTAATGAAACTCGAGTTTCATTAGGTATTGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144842.2-281s1c1
Sequence:CCGGGCTCCAGCAATACCTAATGAACTCGAGTTCATTAGGTATTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144842.2-608s1c1
Sequence:CCGGGCGTTTCAGAATGGAAGATTTCTCGAGAAATCTTCCATTCTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039649
ZMYM5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 5
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000219814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-307s1c1
Sequence:CCGGTCCTGCTTTATTAGGGAATATCTCGAGATATTCCCTAATAAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039649.1-1073s1c1
Sequence:CCGGAGTGCTATTATGTACTCTTTCCTCGAGGAAAGAGTACATAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-582s1c1
Sequence:CCGGCATCTCAGAAAGGAAATATAACTCGAGTTATATTTCCTTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039649
ZMYM5 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 5
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000219814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-307s1c1
Sequence:CCGGTCCTGCTTTATTAGGGAATATCTCGAGATATTCCCTAATAAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039649.1-1073s1c1
Sequence:CCGGAGTGCTATTATGTACTCTTTCCTCGAGGAAAGAGTACATAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-582s1c1
Sequence:CCGGCATCTCAGAAAGGAAATATAACTCGAGTTATATTTCCTTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039649
ZMYM5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 5
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000219814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-307s1c1
Sequence:CCGGTCCTGCTTTATTAGGGAATATCTCGAGATATTCCCTAATAAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039649.1-1073s1c1
Sequence:CCGGAGTGCTATTATGTACTCTTTCCTCGAGGAAAGAGTACATAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039649.1-582s1c1
Sequence:CCGGCATCTCAGAAAGGAAATATAACTCGAGTTATATTTCCTTTCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014242
ZMYM5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-268s1c1
Sequence:CCGGGCTTGTCCTTTAGTCAGTAGACTCGAGTCTACTGACTAAAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-675s1c1
Sequence:CCGGCACTACAGAATTGACTCTGAACTCGAGTTCAGAGTCAATTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-301s1c1
Sequence:CCGGCCAGTGGAAGATGATGATGATCTCGAGATCATCATCATCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-426s1c1
Sequence:CCGGGCCTCAAGGAAATTATTCTGTCTCGAGACAGAATAATTTCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1270s1c1
Sequence:CCGGGCATCTACAAAGAAGGCTAATCTCGAGATTAGCCTTCTTTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1447s1c1
Sequence:CCGGCCTAAGTTGTTGTTTAGGCTACTCGAGTAGCCTAAACAACAACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-374s1c1
Sequence:CCGGCAGCAATAGCTGATCAAAGAACTCGAGTTCTTTGATCAGCTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-931s1c1
Sequence:CCGGGCAGGAGACTTATTTCAGAATCTCGAGATTCTGAAATAAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014242
ZMYM5 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-268s1c1
Sequence:CCGGGCTTGTCCTTTAGTCAGTAGACTCGAGTCTACTGACTAAAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-675s1c1
Sequence:CCGGCACTACAGAATTGACTCTGAACTCGAGTTCAGAGTCAATTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-301s1c1
Sequence:CCGGCCAGTGGAAGATGATGATGATCTCGAGATCATCATCATCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-426s1c1
Sequence:CCGGGCCTCAAGGAAATTATTCTGTCTCGAGACAGAATAATTTCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1270s1c1
Sequence:CCGGGCATCTACAAAGAAGGCTAATCTCGAGATTAGCCTTCTTTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1447s1c1
Sequence:CCGGCCTAAGTTGTTGTTTAGGCTACTCGAGTAGCCTAAACAACAACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-374s1c1
Sequence:CCGGCAGCAATAGCTGATCAAAGAACTCGAGTTCTTTGATCAGCTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-931s1c1
Sequence:CCGGGCAGGAGACTTATTTCAGAATCTCGAGATTCTGAAATAAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014242
ZMYM5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-268s1c1
Sequence:CCGGGCTTGTCCTTTAGTCAGTAGACTCGAGTCTACTGACTAAAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-675s1c1
Sequence:CCGGCACTACAGAATTGACTCTGAACTCGAGTTCAGAGTCAATTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-301s1c1
Sequence:CCGGCCAGTGGAAGATGATGATGATCTCGAGATCATCATCATCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014242.1-426s1c1
Sequence:CCGGGCCTCAAGGAAATTATTCTGTCTCGAGACAGAATAATTTCCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1270s1c1
Sequence:CCGGGCATCTACAAAGAAGGCTAATCTCGAGATTAGCCTTCTTTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-1447s1c1
Sequence:CCGGCCTAAGTTGTTGTTTAGGCTACTCGAGTAGCCTAAACAACAACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014242.1-374s1c1
Sequence:CCGGCAGCAATAGCTGATCAAAGAACTCGAGTTCTTTGATCAGCTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014242.1-931s1c1
Sequence:CCGGGCAGGAGACTTATTTCAGAATCTCGAGATTCTGAAATAAGTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks