EMAIL THIS PAGE TO A FRIEND

ZMYM6

zinc finger, MYM-type 6

Synonyms: Buster2 MYM ZNF198L4 ZNF258
Gene ID:
Mouse(100177) zinc finger, MYM-type 6
Rat(362602) zinc finger, MYM-type 6
naked mole-rat(101708312) zinc finger, MYM-type 6
domestic guinea pig(100723826) zinc finger, MYM-type 6
cow(618234) zinc finger, MYM-type 6
sheep(101108433) zinc finger, MYM-type 6
dog(475341) zinc finger, MYM-type 6
Horse(100629888) zinc finger, MYM-type 6
domestic cat(101084807) zinc finger, MYM-type 6
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096491 MISSION® esiRNA esiRNA human ZMYM6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007167 Rosetta Predictions human pricing
NM_001108681 Rosetta Predictions rat pricing
NM_177462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343099 predicted 1931
2 SASI_Hs01_00168322 predicted 851
3 SASI_Hs01_00168323 predicted 1179
4 SASI_Hs01_00168324 predicted 2094
5 SASI_Hs01_00168325 predicted 1152
6 SASI_Hs01_00168326 predicted 1630
7 SASI_Hs02_00343100 predicted 1898
8 SASI_Hs01_00168330 predicted 391
9 SASI_Hs01_00168331 predicted 813
10 SASI_Hs02_00343101 predicted 1690
11 SASI_Hs01_00168327 predicted 2318
12 SASI_Hs01_00168328 predicted 758
13 SASI_Hs01_00168329 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241025 predicted 1847
2 SASI_Rn02_00241026 predicted 3993
3 SASI_Rn02_00241027 predicted 3968
4 SASI_Rn02_00241028 predicted 3768
5 SASI_Rn02_00241029 predicted 3366
6 SASI_Rn02_00241030 predicted 3205
7 SASI_Rn02_00241031 predicted 938
8 SASI_Rn02_00241032 predicted 2248
9 SASI_Rn02_00241033 predicted 2259
10 SASI_Rn02_00241034 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188399 predicted 951
2 SASI_Mm02_00347663 predicted 2523
3 SASI_Mm01_00188400 predicted 3823
4 SASI_Mm01_00188401 predicted 1855
5 SASI_Mm01_00188402 predicted 3379
6 SASI_Mm01_00188403 predicted 2425
7 SASI_Mm01_00188404 predicted 3218
8 SASI_Mm02_00347664 predicted 2810
9 SASI_Mm01_00188405 predicted 2258
10 SASI_Mm01_00188406 predicted 3328
11 SASI_Mm01_00188407 predicted 2380
12 SASI_Mm01_00188408 predicted 2552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007167
VALIDATED
ZMYM6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 6
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-546s1c1
Sequence:CCGGGATCACAACTCGCTTTGAGAACTCGAGTTCTCAAAGCGAGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-656s1c1
Sequence:CCGGGCATTTCAACTAAGTGCAGTACTCGAGTACTGCACTTAGTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2065s1c1
Sequence:CCGGGCAGCAAAGATCATTCAAGATCTCGAGATCTTGAATGATCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2205s1c1
Sequence:CCGGCAAACCACATACACAGCACAACTCGAGTTGTGCTGTGTATGTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-1693s1c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-2062s1c1
Sequence:CCGGGAGGCAGCAAAGATCATTCAACTCGAGTTGAATGATCTTTGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-1646s1c1
Sequence:CCGGGCAGCTACTGTTCACAGACATCTCGAGATGTCTGTGAACAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_007167.1-417s1c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007167.3-552s21c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4955s1c1
Sequence:CCGGGGCCTTTCTGGCCCAATATACCTCGAGGTATATTGGGCCAGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4899s1c1
Sequence:CCGGAGCAGCTTGGGTAACTATAAACTCGAGTTTATAGTTACCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-3953s21c1
Sequence:CCGGTAGGATTACAAGCACTATTTACTCGAGTAAATAGTGCTTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1233s21c1
Sequence:CCGGCATGTCAAATGGAACTATATACTCGAGTATATAGTTCCATTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007167.3-4448s21c1
Sequence:CCGGTAATGAGAAGCCCAGTTTATACTCGAGTATAAACTGGGCTTCTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1828s21c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007167
VALIDATED
ZMYM6 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 6
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-546s1c1
Sequence:CCGGGATCACAACTCGCTTTGAGAACTCGAGTTCTCAAAGCGAGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-656s1c1
Sequence:CCGGGCATTTCAACTAAGTGCAGTACTCGAGTACTGCACTTAGTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2065s1c1
Sequence:CCGGGCAGCAAAGATCATTCAAGATCTCGAGATCTTGAATGATCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2205s1c1
Sequence:CCGGCAAACCACATACACAGCACAACTCGAGTTGTGCTGTGTATGTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-1693s1c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-2062s1c1
Sequence:CCGGGAGGCAGCAAAGATCATTCAACTCGAGTTGAATGATCTTTGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-1646s1c1
Sequence:CCGGGCAGCTACTGTTCACAGACATCTCGAGATGTCTGTGAACAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_007167.1-417s1c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007167.3-552s21c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4955s1c1
Sequence:CCGGGGCCTTTCTGGCCCAATATACCTCGAGGTATATTGGGCCAGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4899s1c1
Sequence:CCGGAGCAGCTTGGGTAACTATAAACTCGAGTTTATAGTTACCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-3953s21c1
Sequence:CCGGTAGGATTACAAGCACTATTTACTCGAGTAAATAGTGCTTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1233s21c1
Sequence:CCGGCATGTCAAATGGAACTATATACTCGAGTATATAGTTCCATTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007167.3-4448s21c1
Sequence:CCGGTAATGAGAAGCCCAGTTTATACTCGAGTATAAACTGGGCTTCTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1828s21c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007167
VALIDATED
ZMYM6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 6
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-546s1c1
Sequence:CCGGGATCACAACTCGCTTTGAGAACTCGAGTTCTCAAAGCGAGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-656s1c1
Sequence:CCGGGCATTTCAACTAAGTGCAGTACTCGAGTACTGCACTTAGTTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2065s1c1
Sequence:CCGGGCAGCAAAGATCATTCAAGATCTCGAGATCTTGAATGATCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007167.1-2205s1c1
Sequence:CCGGCAAACCACATACACAGCACAACTCGAGTTGTGCTGTGTATGTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-1693s1c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007167.1-2062s1c1
Sequence:CCGGGAGGCAGCAAAGATCATTCAACTCGAGTTGAATGATCTTTGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007167.1-1646s1c1
Sequence:CCGGGCAGCTACTGTTCACAGACATCTCGAGATGTCTGTGAACAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_007167.1-417s1c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007167.3-552s21c1
Sequence:CCGGGACAGGATCTACTCAGCTCTTCTCGAGAAGAGCTGAGTAGATCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4955s1c1
Sequence:CCGGGGCCTTTCTGGCCCAATATACCTCGAGGTATATTGGGCCAGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007167.3-4899s1c1
Sequence:CCGGAGCAGCTTGGGTAACTATAAACTCGAGTTTATAGTTACCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-3953s21c1
Sequence:CCGGTAGGATTACAAGCACTATTTACTCGAGTAAATAGTGCTTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1233s21c1
Sequence:CCGGCATGTCAAATGGAACTATATACTCGAGTATATAGTTCCATTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007167.3-4448s21c1
Sequence:CCGGTAATGAGAAGCCCAGTTTATACTCGAGTATAAACTGGGCTTCTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007167.3-1828s21c1
Sequence:CCGGGAGGGCAAGTTAGAAGAGTTTCTCGAGAAACTCTTCTAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177462
VALIDATED
ZMYM6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYM-type 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-1277s1c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3918s1c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-2670s1c1
Sequence:CCGGCCTCTTTCTAATAGCACAATTCTCGAGAATTGTGCTATTAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3043s1c1
Sequence:CCGGCCAAGAATACAGTGACATTTACTCGAGTAAATGTCACTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-2819s21c1
Sequence:CCGGATGTCCGCTTCATCGACTATGCTCGAGCATAGTCGATGAAGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3916s21c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1275s21c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-755s21c1
Sequence:CCGGAGCCTGTTGTTACCATATATACTCGAGTATATATGGTAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-1916s21c1
Sequence:CCGGTAGCTACAACACCAGTTATAACTCGAGTTATAACTGGTGTTGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3331s21c1
Sequence:CCGGTCAGATTTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1440s21c1
Sequence:CCGGCGACTACTGTAAGCTACAGAACTCGAGTTCTGTAGCTTACAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3377s21c1
Sequence:CCGGTAGCCTATCTAGCAGATATATCTCGAGATATATCTGCTAGATAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177462
VALIDATED
ZMYM6 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYM-type 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-1277s1c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3918s1c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-2670s1c1
Sequence:CCGGCCTCTTTCTAATAGCACAATTCTCGAGAATTGTGCTATTAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3043s1c1
Sequence:CCGGCCAAGAATACAGTGACATTTACTCGAGTAAATGTCACTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-2819s21c1
Sequence:CCGGATGTCCGCTTCATCGACTATGCTCGAGCATAGTCGATGAAGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3916s21c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1275s21c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-755s21c1
Sequence:CCGGAGCCTGTTGTTACCATATATACTCGAGTATATATGGTAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-1916s21c1
Sequence:CCGGTAGCTACAACACCAGTTATAACTCGAGTTATAACTGGTGTTGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3331s21c1
Sequence:CCGGTCAGATTTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1440s21c1
Sequence:CCGGCGACTACTGTAAGCTACAGAACTCGAGTTCTGTAGCTTACAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3377s21c1
Sequence:CCGGTAGCCTATCTAGCAGATATATCTCGAGATATATCTGCTAGATAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177462
VALIDATED
ZMYM6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYM-type 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-1277s1c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3918s1c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-2670s1c1
Sequence:CCGGCCTCTTTCTAATAGCACAATTCTCGAGAATTGTGCTATTAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177462.2-3043s1c1
Sequence:CCGGCCAAGAATACAGTGACATTTACTCGAGTAAATGTCACTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-2819s21c1
Sequence:CCGGATGTCCGCTTCATCGACTATGCTCGAGCATAGTCGATGAAGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3916s21c1
Sequence:CCGGGCATCCAAACAGAGAGACCTTCTCGAGAAGGTCTCTCTGTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1275s21c1
Sequence:CCGGCCAGATTGCTTTGACCCATTTCTCGAGAAATGGGTCAAAGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-755s21c1
Sequence:CCGGAGCCTGTTGTTACCATATATACTCGAGTATATATGGTAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177462.4-1916s21c1
Sequence:CCGGTAGCTACAACACCAGTTATAACTCGAGTTATAACTGGTGTTGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3331s21c1
Sequence:CCGGTCAGATTTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-1440s21c1
Sequence:CCGGCGACTACTGTAAGCTACAGAACTCGAGTTCTGTAGCTTACAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177462.4-3377s21c1
Sequence:CCGGTAGCCTATCTAGCAGATATATCTCGAGATATATCTGCTAGATAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks