EMAIL THIS PAGE TO A FRIEND

ZMYND10

zinc finger, MYND-type containing 10

Synonyms: BLU FLU
UniProtKB ID: O75800, A6NK41, O14570, O75801, Q8N4R6, Q8NDN6
Gene ID:
Mouse(114602) zinc finger, MYND domain containing 10
Rat(363139) zinc finger, MYND-type containing 10
naked mole-rat(101707239) zinc finger, MYND-type containing 10
domestic guinea pig(100717771) zinc finger, MYND-type containing 10
cow(528799) zinc finger, MYND-type containing 10
sheep(101120958) zinc finger, MYND-type containing 10
Zebrafish(393368) zinc finger, MYND-type containing 10
domestic cat(101094912) zinc finger, MYND-type containing 10
dog(476615) zinc finger, MYND-type containing 10
chicken(770538) zinc finger, MYND-type containing 10
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015896 Rosetta Predictions human pricing
NM_001004284 Rosetta Predictions rat pricing
NM_053253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216127 predicted 976
2 SASI_Hs01_00216128 predicted 1501
3 SASI_Hs01_00216129 predicted 729
4 SASI_Hs01_00216130 predicted 751
5 SASI_Hs01_00216131 predicted 1085
6 SASI_Hs01_00216132 predicted 1269
7 SASI_Hs01_00216133 predicted 971
8 SASI_Hs01_00216134 predicted 699
9 SASI_Hs01_00216135 predicted 1396
10 SASI_Hs01_00216136 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034422 predicted 866
2 SASI_Rn01_00034423 predicted 621
3 SASI_Rn01_00034424 predicted 680
4 SASI_Rn01_00034425 predicted 407
5 SASI_Rn01_00034426 predicted 721
6 SASI_Rn01_00034427 predicted 1074
7 SASI_Rn01_00034428 predicted 1326
8 SASI_Rn01_00034429 predicted 859
9 SASI_Rn01_00034431 predicted 928
10 SASI_Rn02_00198331 predicted 1335
11 SASI_Rn01_00034430 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172575 predicted 1235
2 SASI_Mm01_00172576 predicted 498
3 SASI_Mm01_00172577 predicted 1050
4 SASI_Mm01_00172578 predicted 680
5 SASI_Mm01_00172579 predicted 724
6 SASI_Mm01_00172580 predicted 1114
7 SASI_Mm01_00172582 predicted 907
8 SASI_Mm02_00337870 predicted 734
9 SASI_Mm01_00172583 predicted 476
10 SASI_Mm01_00172584 predicted 282
11 SASI_Mm01_00172581 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053253
ZMYND10 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-670s21c1
Sequence:CCGGCAGGCGGAGATGATGGAATTTCTCGAGAAATTCCATCATCTCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-283s21c1
Sequence:CCGGGCCATCCTTGATGCAACTATCCTCGAGGATAGTTGCATCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-1209s21c1
Sequence:CCGGGCACCAGCTTCAGCACGTATTCTCGAGAATACGTGCTGAAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-549s21c1
Sequence:CCGGCTTGGACCTAGTAGACTATTGCTCGAGCAATAGTCTACTAGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-910s1c1
Sequence:CCGGCTGAATAAACTGGATGGGCAACTCGAGTTGCCCATCCAGTTTATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-1240s1c1
Sequence:CCGGGAGAAGGATCTTCGTCAACAACTCGAGTTGTTGACGAAGATCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-235s1c1
Sequence:CCGGGAAGGGTGGAATAAGCAGCATCTCGAGATGCTGCTTATTCCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053253
ZMYND10 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-670s21c1
Sequence:CCGGCAGGCGGAGATGATGGAATTTCTCGAGAAATTCCATCATCTCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-283s21c1
Sequence:CCGGGCCATCCTTGATGCAACTATCCTCGAGGATAGTTGCATCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-1209s21c1
Sequence:CCGGGCACCAGCTTCAGCACGTATTCTCGAGAATACGTGCTGAAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-549s21c1
Sequence:CCGGCTTGGACCTAGTAGACTATTGCTCGAGCAATAGTCTACTAGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-910s1c1
Sequence:CCGGCTGAATAAACTGGATGGGCAACTCGAGTTGCCCATCCAGTTTATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-1240s1c1
Sequence:CCGGGAGAAGGATCTTCGTCAACAACTCGAGTTGTTGACGAAGATCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-235s1c1
Sequence:CCGGGAAGGGTGGAATAAGCAGCATCTCGAGATGCTGCTTATTCCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053253
ZMYND10 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-670s21c1
Sequence:CCGGCAGGCGGAGATGATGGAATTTCTCGAGAAATTCCATCATCTCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-283s21c1
Sequence:CCGGGCCATCCTTGATGCAACTATCCTCGAGGATAGTTGCATCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-1209s21c1
Sequence:CCGGGCACCAGCTTCAGCACGTATTCTCGAGAATACGTGCTGAAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053253.3-549s21c1
Sequence:CCGGCTTGGACCTAGTAGACTATTGCTCGAGCAATAGTCTACTAGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-910s1c1
Sequence:CCGGCTGAATAAACTGGATGGGCAACTCGAGTTGCCCATCCAGTTTATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-1240s1c1
Sequence:CCGGGAGAAGGATCTTCGTCAACAACTCGAGTTGTTGACGAAGATCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053253.2-235s1c1
Sequence:CCGGGAAGGGTGGAATAAGCAGCATCTCGAGATGCTGCTTATTCCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015896
VALIDATED
ZMYND10 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1503s21c1
Sequence:CCGGCAAGGGAATCCACCCAGAATGCTCGAGCATTCTGGGTGGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1367s21c1
Sequence:CCGGATGCCAGAATGAGTGGTATTGCTCGAGCAATACCACTCATTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1335s21c1
Sequence:CCGGTGCAGTGCAGAGGCTTCTAAGCTCGAGCTTAGAAGCCTCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1136s21c1
Sequence:CCGGGTTGGAACAGATCCCAGAAATCTCGAGATTTCTGGGATCTGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015896.2-548s21c1
Sequence:CCGGCTTGGACTTGGTAGACTATTGCTCGAGCAATAGTCTACCAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015896.2-767s1c1
Sequence:CCGGCCGTATGCTTAGCACACACAACTCGAGTTGTGTGTGCTAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-1366s1c1
Sequence:CCGGGATGCCAGAATGAGTGGTATTCTCGAGAATACCACTCATTCTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-546s1c1
Sequence:CCGGGTCTTGGACTTGGTAGACTATCTCGAGATAGTCTACCAAGTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-266s1c1
Sequence:CCGGGAAGCTGAACATGCAAGCCATCTCGAGATGGCTTGCATGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015896
VALIDATED
ZMYND10 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1503s21c1
Sequence:CCGGCAAGGGAATCCACCCAGAATGCTCGAGCATTCTGGGTGGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1367s21c1
Sequence:CCGGATGCCAGAATGAGTGGTATTGCTCGAGCAATACCACTCATTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1335s21c1
Sequence:CCGGTGCAGTGCAGAGGCTTCTAAGCTCGAGCTTAGAAGCCTCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1136s21c1
Sequence:CCGGGTTGGAACAGATCCCAGAAATCTCGAGATTTCTGGGATCTGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015896.2-548s21c1
Sequence:CCGGCTTGGACTTGGTAGACTATTGCTCGAGCAATAGTCTACCAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015896.2-767s1c1
Sequence:CCGGCCGTATGCTTAGCACACACAACTCGAGTTGTGTGTGCTAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-1366s1c1
Sequence:CCGGGATGCCAGAATGAGTGGTATTCTCGAGAATACCACTCATTCTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-546s1c1
Sequence:CCGGGTCTTGGACTTGGTAGACTATCTCGAGATAGTCTACCAAGTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-266s1c1
Sequence:CCGGGAAGCTGAACATGCAAGCCATCTCGAGATGGCTTGCATGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015896
VALIDATED
ZMYND10 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1503s21c1
Sequence:CCGGCAAGGGAATCCACCCAGAATGCTCGAGCATTCTGGGTGGATTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1367s21c1
Sequence:CCGGATGCCAGAATGAGTGGTATTGCTCGAGCAATACCACTCATTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1335s21c1
Sequence:CCGGTGCAGTGCAGAGGCTTCTAAGCTCGAGCTTAGAAGCCTCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015896.2-1136s21c1
Sequence:CCGGGTTGGAACAGATCCCAGAAATCTCGAGATTTCTGGGATCTGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015896.2-548s21c1
Sequence:CCGGCTTGGACTTGGTAGACTATTGCTCGAGCAATAGTCTACCAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015896.2-767s1c1
Sequence:CCGGCCGTATGCTTAGCACACACAACTCGAGTTGTGTGTGCTAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-1366s1c1
Sequence:CCGGGATGCCAGAATGAGTGGTATTCTCGAGAATACCACTCATTCTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-546s1c1
Sequence:CCGGGTCTTGGACTTGGTAGACTATCTCGAGATAGTCTACCAAGTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015896.2-266s1c1
Sequence:CCGGGAAGCTGAACATGCAAGCCATCTCGAGATGGCTTGCATGTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks