EMAIL THIS PAGE TO A FRIEND

ZMYND11

zinc finger, MYND-type containing 11

Synonyms: BRAM1 BS69
Gene ID:
Human(10771) Summary: The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(66505) zinc finger, MYND domain containing 11
Rat(291259) zinc finger, MYND-type containing 11
Zebrafish(553781) zinc finger, MYND domain containing 11
dog(478023) zinc finger, MYND-type containing 11
chicken(420455) zinc finger, MYND-type containing 11
Horse(100057731) zinc finger, MYND-type containing 11
cow(506325) zinc finger, MYND-type containing 11
sheep(101112998) zinc finger, MYND-type containing 11
domestic guinea pig(100718229) zinc finger, MYND-type containing 11
naked mole-rat(101715955) zinc finger, MYND-type containing 11
Domestic Rabbit(100358047) zinc finger, MYND-type containing 11
253 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500157 Anti-ZMY11 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
AV34704 Anti-ZMyND11 (AB1) antibody produced in rabbit IgG fraction of antiserum human, rat, rabbit, bovine, mouse, canine, guinea pig, horse
immunohistochemistry, western blot pricing
AV34705 Anti-ZMyND11 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, mouse, horse, rat, canine, human, rabbit
immunohistochemistry, western blot pricing
SAB2501744 Anti-ZMYND11 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, mouse, pig, canine, rat
ELISA, western blot pricing
HPA015816 Anti-ZMYND11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133231 MISSION® esiRNA esiRNA human ZMYND11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006624 Rosetta Predictions human pricing
NM_212479 Rosetta Predictions human pricing
NM_203366 Rosetta Predictions rat pricing
NM_203367 Rosetta Predictions rat pricing
NM_203368 Rosetta Predictions rat pricing
NM_203369 Rosetta Predictions rat pricing
NM_144516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229818 predicted 827
2 SASI_Hs01_00229819 predicted 380
3 SASI_Hs01_00229820 predicted 1387
4 SASI_Hs01_00229821 predicted 1531
5 SASI_Hs01_00229822 predicted 926
6 SASI_Hs02_00341970 predicted 945
7 SASI_Hs01_00229823 predicted 704
8 SASI_Hs01_00229824 predicted 866
9 SASI_Hs01_00229825 predicted 1175
10 SASI_Hs01_00229826 predicted 675
11 SASI_Hs01_00229827 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212760 predicted 823
2 SASI_Hs01_00212761 predicted 380
3 SASI_Hs01_00212762 predicted 1386
4 SASI_Hs01_00212763 predicted 1525
5 SASI_Hs01_00212764 predicted 927
6 SASI_Hs02_00374206 predicted 941
7 SASI_Hs01_00212765 predicted 705
8 SASI_Hs01_00212766 predicted 866
9 SASI_Hs01_00212767 predicted 1175
10 SASI_Hs01_00212768 predicted 683
11 SASI_Hs01_00212769 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114828 predicted 576
2 SASI_Rn01_00114829 predicted 1371
3 SASI_Rn01_00114830 predicted 716
4 SASI_Rn01_00114831 predicted 535
5 SASI_Rn01_00114833 predicted 694
6 SASI_Rn01_00114834 predicted 539
7 SASI_Rn01_00114835 predicted 587
8 SASI_Rn01_00114836 predicted 858
9 SASI_Rn01_00114837 predicted 689
10 SASI_Rn02_00270364 predicted 1312
11 SASI_Rn01_00114832 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085487 predicted 572
2 SASI_Rn01_00085488 predicted 1544
3 SASI_Rn01_00085489 predicted 711
4 SASI_Rn01_00085490 predicted 531
5 SASI_Rn01_00085492 predicted 696
6 SASI_Rn01_00085493 predicted 534
7 SASI_Rn01_00085494 predicted 595
8 SASI_Rn01_00085495 predicted 860
9 SASI_Rn01_00085496 predicted 688
10 SASI_Rn02_00270365 predicted 1482
11 SASI_Rn01_00085491 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034524 predicted 408
2 SASI_Rn01_00034525 predicted 1210
3 SASI_Rn01_00034526 predicted 550
4 SASI_Rn01_00034527 predicted 368
5 SASI_Rn01_00034529 predicted 529
6 SASI_Rn01_00034530 predicted 372
7 SASI_Rn01_00034531 predicted 428
8 SASI_Rn01_00034532 predicted 701
9 SASI_Rn01_00034533 predicted 525
10 SASI_Rn02_00270366 predicted 1157
11 SASI_Rn01_00034528 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097046 predicted 631
2 SASI_Rn01_00097047 predicted 1601
3 SASI_Rn01_00097048 predicted 772
4 SASI_Rn01_00097049 predicted 592
5 SASI_Rn01_00097051 predicted 746
6 SASI_Rn01_00097052 predicted 593
7 SASI_Rn01_00097053 predicted 648
8 SASI_Rn01_00097054 predicted 919
9 SASI_Rn01_00097055 predicted 742
10 SASI_Rn02_00270367 predicted 1537
11 SASI_Rn01_00097050 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110847 predicted 342
2 SASI_Mm01_00110848 predicted 1185
3 SASI_Mm01_00110849 predicted 987
4 SASI_Mm01_00110850 predicted 726
5 SASI_Mm01_00110851 predicted 1134
6 SASI_Mm01_00110852 predicted 1083
7 SASI_Mm01_00110853 predicted 480
8 SASI_Mm01_00110854 predicted 407
9 SASI_Mm02_00340033 predicted 337
10 SASI_Mm01_00110855 predicted 528
11 SASI_Mm01_00110856 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006624
VALIDATED
ZMYND11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1266s1c1
Sequence:CCGGCCACCAGTAATGAGCAGCTAACTCGAGTTAGCTGCTCATTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-929s1c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-550s1c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1429s1c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-743s1c1
Sequence:CCGGGAAGGGAAATACCGAAGTTATCTCGAGATAACTTCGGTATTTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-926s21c1
Sequence:CCGGCATTGCGAGGATGCTATATAACTCGAGTTATATAGCATCCTCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006624.3-1514s21c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-2214s21c1
Sequence:CCGGACATCAGTGGAGGGTATTATTCTCGAGAATAATACCCTCCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-635s21c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-1014s21c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006624
VALIDATED
ZMYND11 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1266s1c1
Sequence:CCGGCCACCAGTAATGAGCAGCTAACTCGAGTTAGCTGCTCATTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-929s1c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-550s1c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1429s1c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-743s1c1
Sequence:CCGGGAAGGGAAATACCGAAGTTATCTCGAGATAACTTCGGTATTTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-926s21c1
Sequence:CCGGCATTGCGAGGATGCTATATAACTCGAGTTATATAGCATCCTCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006624.3-1514s21c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-2214s21c1
Sequence:CCGGACATCAGTGGAGGGTATTATTCTCGAGAATAATACCCTCCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-635s21c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-1014s21c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006624
VALIDATED
ZMYND11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1266s1c1
Sequence:CCGGCCACCAGTAATGAGCAGCTAACTCGAGTTAGCTGCTCATTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-929s1c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-550s1c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006624.1-1429s1c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006624.1-743s1c1
Sequence:CCGGGAAGGGAAATACCGAAGTTATCTCGAGATAACTTCGGTATTTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-926s21c1
Sequence:CCGGCATTGCGAGGATGCTATATAACTCGAGTTATATAGCATCCTCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006624.3-1514s21c1
Sequence:CCGGCGTGTCAACTCAGACAAAGAACTCGAGTTCTTTGTCTGAGTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-2214s21c1
Sequence:CCGGACATCAGTGGAGGGTATTATTCTCGAGAATAATACCCTCCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-635s21c1
Sequence:CCGGCCCAGTTTGCAGGAGCATTAACTCGAGTTAATGCTCCTGCAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006624.3-1014s21c1
Sequence:CCGGCCTGACAACTGGTTCTGTTATCTCGAGATAACAGAACCAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144516
VALIDATED
ZMYND11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-271s1c1
Sequence:CCGGGCTGTGAAAGATGGTCTTATTCTCGAGAATAAGACCATCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1279s1c1
Sequence:CCGGGCAAAGAAAGGACGACGTAATCTCGAGATTACGTCGTCCTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144516.1-2836s1c1
Sequence:CCGGCCGTTCCTTGTATTAAAGATACTCGAGTATCTTTAATACAAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1415s1c1
Sequence:CCGGCCAAGAAGTTAAGTGCCTCTTCTCGAGAAGAGGCACTTAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144516.1-549s1c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-437s21c1
Sequence:CCGGAGGAGATGAGATTAGCATTAACTCGAGTTAATGCTAATCTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-265s21c1
Sequence:CCGGTTGCCAACATTGATCGTATTACTCGAGTAATACGATCAATGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-464s21c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-2263s21c1
Sequence:CCGGCTGGCGGCATGTGATTGAATACTCGAGTATTCAATCACATGCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-724s21c1
Sequence:CCGGCGGACATTGCACGGATGTTATCTCGAGATAACATCCGTGCAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-1997s21c1
Sequence:CCGGTGGAGGGTACTACTCTAAATACTCGAGTATTTAGAGTAGTACCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144516
VALIDATED
ZMYND11 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-271s1c1
Sequence:CCGGGCTGTGAAAGATGGTCTTATTCTCGAGAATAAGACCATCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1279s1c1
Sequence:CCGGGCAAAGAAAGGACGACGTAATCTCGAGATTACGTCGTCCTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144516.1-2836s1c1
Sequence:CCGGCCGTTCCTTGTATTAAAGATACTCGAGTATCTTTAATACAAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1415s1c1
Sequence:CCGGCCAAGAAGTTAAGTGCCTCTTCTCGAGAAGAGGCACTTAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144516.1-549s1c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-437s21c1
Sequence:CCGGAGGAGATGAGATTAGCATTAACTCGAGTTAATGCTAATCTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-265s21c1
Sequence:CCGGTTGCCAACATTGATCGTATTACTCGAGTAATACGATCAATGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-464s21c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-2263s21c1
Sequence:CCGGCTGGCGGCATGTGATTGAATACTCGAGTATTCAATCACATGCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-724s21c1
Sequence:CCGGCGGACATTGCACGGATGTTATCTCGAGATAACATCCGTGCAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-1997s21c1
Sequence:CCGGTGGAGGGTACTACTCTAAATACTCGAGTATTTAGAGTAGTACCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144516
VALIDATED
ZMYND11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 11
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-271s1c1
Sequence:CCGGGCTGTGAAAGATGGTCTTATTCTCGAGAATAAGACCATCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1279s1c1
Sequence:CCGGGCAAAGAAAGGACGACGTAATCTCGAGATTACGTCGTCCTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144516.1-2836s1c1
Sequence:CCGGCCGTTCCTTGTATTAAAGATACTCGAGTATCTTTAATACAAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144516.1-1415s1c1
Sequence:CCGGCCAAGAAGTTAAGTGCCTCTTCTCGAGAAGAGGCACTTAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144516.1-549s1c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-437s21c1
Sequence:CCGGAGGAGATGAGATTAGCATTAACTCGAGTTAATGCTAATCTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-265s21c1
Sequence:CCGGTTGCCAACATTGATCGTATTACTCGAGTAATACGATCAATGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144516.2-464s21c1
Sequence:CCGGGCACTCTAACAAGCAGGAAATCTCGAGATTTCCTGCTTGTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-2263s21c1
Sequence:CCGGCTGGCGGCATGTGATTGAATACTCGAGTATTCAATCACATGCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144516.2-724s21c1
Sequence:CCGGCGGACATTGCACGGATGTTATCTCGAGATAACATCCGTGCAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144516.2-1997s21c1
Sequence:CCGGTGGAGGGTACTACTCTAAATACTCGAGTATTTAGAGTAGTACCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks