EMAIL THIS PAGE TO A FRIEND

ZMYND12

zinc finger, MYND-type containing 12

UniProtKB ID: Q9H0C1, Q5VUS6, Q8TC87, Q96M51
Gene ID:
Mouse(332934) zinc finger, MYND domain containing 12
Rat(313552) zinc finger, MYND-type containing 12
naked mole-rat(101723251) zinc finger, MYND-type containing 12
domestic guinea pig(100713325) zinc finger, MYND-type containing 12
cow(512257) zinc finger, MYND-type containing 12
sheep(101105195) zinc finger, MYND-type containing 12
chicken(419510) zinc finger, MYND-type containing 12
dog(482444) zinc finger, MYND-type containing 12
domestic cat(101093122) zinc finger, MYND-type containing 12
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032257 Rosetta Predictions human pricing
NM_001107970 Rosetta Predictions rat pricing
NM_001014900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096714 predicted 1345
2 SASI_Hs01_00096715 predicted 902
3 SASI_Hs01_00096716 predicted 421
4 SASI_Hs01_00096717 predicted 506
5 SASI_Hs01_00096718 predicted 811
6 SASI_Hs01_00096719 predicted 561
7 SASI_Hs02_00359564 predicted 1022
8 SASI_Hs01_00096721 predicted 1069
9 SASI_Hs01_00096722 predicted 1205
10 SASI_Hs01_00096723 predicted 690
11 SASI_Hs01_00096720 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234085 predicted 656
2 SASI_Rn02_00234086 predicted 832
3 SASI_Rn02_00234087 predicted 558
4 SASI_Rn02_00234088 predicted 312
5 SASI_Rn02_00234089 predicted 798
6 SASI_Rn02_00234090 predicted 946
7 SASI_Rn02_00234091 predicted 350
8 SASI_Rn02_00234092 predicted 333
9 SASI_Rn02_00234093 predicted 520
10 SASI_Rn02_00234094 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074056 predicted 587
2 SASI_Mm01_00074057 predicted 437
3 SASI_Mm01_00074058 predicted 290
4 SASI_Mm01_00074059 predicted 257
5 SASI_Mm01_00074060 predicted 523
6 SASI_Mm01_00074061 predicted 776
7 SASI_Mm01_00074062 predicted 881
8 SASI_Mm01_00074063 predicted 659
9 SASI_Mm01_00074064 predicted 218
10 SASI_Mm01_00074065 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032257
ZMYND12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032257.4-1492s21c1
Sequence:CCGGTTGCACACATAGCTGTTATTTCTCGAGAAATAACAGCTATGTGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032257.4-357s21c1
Sequence:CCGGGGCCTGCACAGTCACTTATTACTCGAGTAATAAGTGACTGTGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032257.3-1437s1c1
Sequence:CCGGGAGGTACTGTAGACTGCTGAACTCGAGTTCAGCAGTCTACAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-692s1c1
Sequence:CCGGCGAATCGTTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAACGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-531s1c1
Sequence:CCGGGCTACACCATAGCCCAGAAATCTCGAGATTTCTGGGCTATGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032257.3-1427s1c1
Sequence:CCGGCAACTGCTTTGAGGTACTGTACTCGAGTACAGTACCTCAAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-693s1c1
Sequence:CCGGGAATCGTTCAGGCTGAAGAATCTCGAGATTCTTCAGCCTGAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-1117s1c1
Sequence:CCGGCATCCTGACTTCAATCTTGAACTCGAGTTCAAGATTGAAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032257
ZMYND12 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032257.4-1492s21c1
Sequence:CCGGTTGCACACATAGCTGTTATTTCTCGAGAAATAACAGCTATGTGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032257.4-357s21c1
Sequence:CCGGGGCCTGCACAGTCACTTATTACTCGAGTAATAAGTGACTGTGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032257.3-1437s1c1
Sequence:CCGGGAGGTACTGTAGACTGCTGAACTCGAGTTCAGCAGTCTACAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-692s1c1
Sequence:CCGGCGAATCGTTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAACGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-531s1c1
Sequence:CCGGGCTACACCATAGCCCAGAAATCTCGAGATTTCTGGGCTATGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032257.3-1427s1c1
Sequence:CCGGCAACTGCTTTGAGGTACTGTACTCGAGTACAGTACCTCAAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-693s1c1
Sequence:CCGGGAATCGTTCAGGCTGAAGAATCTCGAGATTCTTCAGCCTGAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-1117s1c1
Sequence:CCGGCATCCTGACTTCAATCTTGAACTCGAGTTCAAGATTGAAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032257
ZMYND12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032257.4-1492s21c1
Sequence:CCGGTTGCACACATAGCTGTTATTTCTCGAGAAATAACAGCTATGTGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032257.4-357s21c1
Sequence:CCGGGGCCTGCACAGTCACTTATTACTCGAGTAATAAGTGACTGTGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032257.3-1437s1c1
Sequence:CCGGGAGGTACTGTAGACTGCTGAACTCGAGTTCAGCAGTCTACAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-692s1c1
Sequence:CCGGCGAATCGTTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAACGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-531s1c1
Sequence:CCGGGCTACACCATAGCCCAGAAATCTCGAGATTTCTGGGCTATGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032257.3-1427s1c1
Sequence:CCGGCAACTGCTTTGAGGTACTGTACTCGAGTACAGTACCTCAAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-693s1c1
Sequence:CCGGGAATCGTTCAGGCTGAAGAATCTCGAGATTCTTCAGCCTGAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032257.3-1117s1c1
Sequence:CCGGCATCCTGACTTCAATCTTGAACTCGAGTTCAAGATTGAAGTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014900
ZMYND12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-789s1c1
Sequence:CCGGGTTCCCAACAAACAGATTTACCTCGAGGTAAATCTGTTTGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-153s21c1
Sequence:CCGGACAGCATCCATGCGAAGATATCTCGAGATATCTTCGCATGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-876s21c1
Sequence:CCGGTAACTTCAACCCTGATCATTCCTCGAGGAATGATCAGGGTTGAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-663s21c1
Sequence:CCGGACTTCCACCTGGCCAATATTTCTCGAGAAATATTGGCCAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-512s21c1
Sequence:CCGGAGTAACGCCACCCACTCTTTACTCGAGTAAAGAGTGGGTGGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-100s21c1
Sequence:CCGGGGCCTGTACAGTCACTTATTACTCGAGTAATAAGTGACTGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-885s1c1
Sequence:CCGGCCCTGATCATTCAAGAATCTACTCGAGTAGATTCTTGAATGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-464s1c1
Sequence:CCGGGAATATCTATCCCAAGCCCAACTCGAGTTGGGCTTGGGATAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014900
ZMYND12 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-789s1c1
Sequence:CCGGGTTCCCAACAAACAGATTTACCTCGAGGTAAATCTGTTTGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-153s21c1
Sequence:CCGGACAGCATCCATGCGAAGATATCTCGAGATATCTTCGCATGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-876s21c1
Sequence:CCGGTAACTTCAACCCTGATCATTCCTCGAGGAATGATCAGGGTTGAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-663s21c1
Sequence:CCGGACTTCCACCTGGCCAATATTTCTCGAGAAATATTGGCCAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-512s21c1
Sequence:CCGGAGTAACGCCACCCACTCTTTACTCGAGTAAAGAGTGGGTGGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-100s21c1
Sequence:CCGGGGCCTGTACAGTCACTTATTACTCGAGTAATAAGTGACTGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-885s1c1
Sequence:CCGGCCCTGATCATTCAAGAATCTACTCGAGTAGATTCTTGAATGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-464s1c1
Sequence:CCGGGAATATCTATCCCAAGCCCAACTCGAGTTGGGCTTGGGATAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014900
ZMYND12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-789s1c1
Sequence:CCGGGTTCCCAACAAACAGATTTACCTCGAGGTAAATCTGTTTGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-153s21c1
Sequence:CCGGACAGCATCCATGCGAAGATATCTCGAGATATCTTCGCATGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-876s21c1
Sequence:CCGGTAACTTCAACCCTGATCATTCCTCGAGGAATGATCAGGGTTGAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-663s21c1
Sequence:CCGGACTTCCACCTGGCCAATATTTCTCGAGAAATATTGGCCAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-512s21c1
Sequence:CCGGAGTAACGCCACCCACTCTTTACTCGAGTAAAGAGTGGGTGGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014900.1-100s21c1
Sequence:CCGGGGCCTGTACAGTCACTTATTACTCGAGTAATAAGTGACTGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-885s1c1
Sequence:CCGGCCCTGATCATTCAAGAATCTACTCGAGTAGATTCTTGAATGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014900.1-464s1c1
Sequence:CCGGGAATATCTATCCCAAGCCCAACTCGAGTTGGGCTTGGGATAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks