EMAIL THIS PAGE TO A FRIEND

ZMYND15

zinc finger, MYND-type containing 15

UniProtKB ID: Q9H091, B4DXY5, I3L296
Gene ID:
Human(84225) Summary: This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Mouse(574428) zinc finger, MYND-type containing 15
Rat(287457) zinc finger, MYND-type containing 15
dog(607219) zinc finger, MYND-type containing 15
Horse(100061402) zinc finger, MYND-type containing 15
domestic cat(101092901) zinc finger, MYND-type containing 15
cow(539735) zinc finger, MYND-type containing 15
sheep(101111466) zinc finger, MYND-type containing 15
domestic guinea pig(100720504) zinc finger, MYND-type containing 15
naked mole-rat(101711584) zinc finger, MYND-type containing 15
Domestic Rabbit(100341459) zinc finger, MYND-type containing 15
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023286 Anti-ZMYND15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032265 Rosetta Predictions human pricing
NM_001105800 Rosetta Predictions rat pricing
NM_001029929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225364 predicted 692
2 SASI_Hs01_00225365 predicted 980
3 SASI_Hs01_00225366 predicted 1182
4 SASI_Hs01_00225367 predicted 1767
5 SASI_Hs01_00225368 predicted 669
6 SASI_Hs01_00225369 predicted 650
7 SASI_Hs01_00225372 predicted 1034
8 SASI_Hs01_00225373 predicted 1022
9 SASI_Hs02_00359572 predicted 1299
10 SASI_Hs02_00359573 predicted 965
11 SASI_Hs01_00225370 predicted 1305
12 SASI_Hs01_00225371 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212656 predicted 1652
2 SASI_Rn02_00212657 predicted 1168
3 SASI_Rn02_00212658 predicted 579
4 SASI_Rn02_00212659 predicted 533
5 SASI_Rn02_00212660 predicted 2336
6 SASI_Rn02_00212661 predicted 1631
7 SASI_Rn02_00212662 predicted 2025
8 SASI_Rn02_00212663 predicted 546
9 SASI_Rn02_00212664 predicted 1516
10 SASI_Rn02_00212665 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056166 predicted 475
2 SASI_Mm01_00056167 predicted 1106
3 SASI_Mm01_00056168 predicted 522
4 SASI_Mm01_00056169 predicted 2280
5 SASI_Mm01_00056170 predicted 1598
6 SASI_Mm01_00056171 predicted 1110
7 SASI_Mm01_00056172 predicted 1615
8 SASI_Mm01_00056173 predicted 1828
9 SASI_Mm01_00056174 predicted 1598
10 SASI_Mm01_00056175 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032265
ZMYND15 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 15
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-2005s1c1
Sequence:CCGGCTGGTTTACAAGCCTGCTCAACTCGAGTTGAGCAGGCTTGTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1090s1c1
Sequence:CCGGGATGATGTGAGTCACCGATTTCTCGAGAAATCGGTGACTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-886s1c1
Sequence:CCGGCCAAGGCTAGGTGTGAAGTTACTCGAGTAACTTCACACCTAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1026s1c1
Sequence:CCGGCCAGTGTAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-645s1c1
Sequence:CCGGGCACGTTTCCTGTCTCTTACTCTCGAGAGTAAGAGACAGGAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1743s1c1
Sequence:CCGGGCCTGACCTGGTTATTGGATTCTCGAGAATCCAATAACCAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-891s1c1
Sequence:CCGGGCTAGGTGTGAAGTTAGCCAACTCGAGTTGGCTAACTTCACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1540s1c1
Sequence:CCGGGAGCTGCAGTTTGTAGGTGATCTCGAGATCACCTACAAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-581s21c1
Sequence:CCGGACAGGGTGGAGAACGAAACAACTCGAGTTGTTTCGTTCTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1572s21c1
Sequence:CCGGCGAAAGCGACGAGCAGCATTTCTCGAGAAATGCTGCTCGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1745s21c1
Sequence:CCGGCTGACCTGGTTATTGGATTTACTCGAGTAAATCCAATAACCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-95s21c1
Sequence:CCGGTCGGCTGGTTCCGAAAGTTTGCTCGAGCAAACTTTCGGAACCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-218s21c1
Sequence:CCGGATGTCCTGCCCAACCATAGTGCTCGAGCACTATGGTTGGGCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032265
ZMYND15 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 15
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-2005s1c1
Sequence:CCGGCTGGTTTACAAGCCTGCTCAACTCGAGTTGAGCAGGCTTGTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1090s1c1
Sequence:CCGGGATGATGTGAGTCACCGATTTCTCGAGAAATCGGTGACTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-886s1c1
Sequence:CCGGCCAAGGCTAGGTGTGAAGTTACTCGAGTAACTTCACACCTAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1026s1c1
Sequence:CCGGCCAGTGTAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-645s1c1
Sequence:CCGGGCACGTTTCCTGTCTCTTACTCTCGAGAGTAAGAGACAGGAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1743s1c1
Sequence:CCGGGCCTGACCTGGTTATTGGATTCTCGAGAATCCAATAACCAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-891s1c1
Sequence:CCGGGCTAGGTGTGAAGTTAGCCAACTCGAGTTGGCTAACTTCACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1540s1c1
Sequence:CCGGGAGCTGCAGTTTGTAGGTGATCTCGAGATCACCTACAAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-581s21c1
Sequence:CCGGACAGGGTGGAGAACGAAACAACTCGAGTTGTTTCGTTCTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1572s21c1
Sequence:CCGGCGAAAGCGACGAGCAGCATTTCTCGAGAAATGCTGCTCGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1745s21c1
Sequence:CCGGCTGACCTGGTTATTGGATTTACTCGAGTAAATCCAATAACCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-95s21c1
Sequence:CCGGTCGGCTGGTTCCGAAAGTTTGCTCGAGCAAACTTTCGGAACCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-218s21c1
Sequence:CCGGATGTCCTGCCCAACCATAGTGCTCGAGCACTATGGTTGGGCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032265
ZMYND15 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 15
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-2005s1c1
Sequence:CCGGCTGGTTTACAAGCCTGCTCAACTCGAGTTGAGCAGGCTTGTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1090s1c1
Sequence:CCGGGATGATGTGAGTCACCGATTTCTCGAGAAATCGGTGACTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-886s1c1
Sequence:CCGGCCAAGGCTAGGTGTGAAGTTACTCGAGTAACTTCACACCTAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-1026s1c1
Sequence:CCGGCCAGTGTAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-645s1c1
Sequence:CCGGGCACGTTTCCTGTCTCTTACTCTCGAGAGTAAGAGACAGGAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1743s1c1
Sequence:CCGGGCCTGACCTGGTTATTGGATTCTCGAGAATCCAATAACCAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032265.1-891s1c1
Sequence:CCGGGCTAGGTGTGAAGTTAGCCAACTCGAGTTGGCTAACTTCACACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032265.1-1540s1c1
Sequence:CCGGGAGCTGCAGTTTGTAGGTGATCTCGAGATCACCTACAAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-581s21c1
Sequence:CCGGACAGGGTGGAGAACGAAACAACTCGAGTTGTTTCGTTCTCCACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1572s21c1
Sequence:CCGGCGAAAGCGACGAGCAGCATTTCTCGAGAAATGCTGCTCGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-1745s21c1
Sequence:CCGGCTGACCTGGTTATTGGATTTACTCGAGTAAATCCAATAACCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-95s21c1
Sequence:CCGGTCGGCTGGTTCCGAAAGTTTGCTCGAGCAAACTTTCGGAACCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032265.1-218s21c1
Sequence:CCGGATGTCCTGCCCAACCATAGTGCTCGAGCACTATGGTTGGGCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029929
ZMYND15 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 15
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-1747s1c1
Sequence:CCGGCCTTCTCAACGGTGATCCTTACTCGAGTAAGGATCACCGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2282s1c1
Sequence:CCGGCCTGACCTGGTTATTGGATTTCTCGAGAAATCCAATAACCAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2518s1c1
Sequence:CCGGGTACTGCAACGCCTTCATCTTCTCGAGAAGATGAAGGCGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2310s1c1
Sequence:CCGGGCTTTGGTCTCAAAGATACATCTCGAGATGTATCTTTGAGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029929
ZMYND15 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 15
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-1747s1c1
Sequence:CCGGCCTTCTCAACGGTGATCCTTACTCGAGTAAGGATCACCGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2282s1c1
Sequence:CCGGCCTGACCTGGTTATTGGATTTCTCGAGAAATCCAATAACCAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2518s1c1
Sequence:CCGGGTACTGCAACGCCTTCATCTTCTCGAGAAGATGAAGGCGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2310s1c1
Sequence:CCGGGCTTTGGTCTCAAAGATACATCTCGAGATGTATCTTTGAGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029929
ZMYND15 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 15
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-1747s1c1
Sequence:CCGGCCTTCTCAACGGTGATCCTTACTCGAGTAAGGATCACCGTTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2282s1c1
Sequence:CCGGCCTGACCTGGTTATTGGATTTCTCGAGAAATCCAATAACCAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2518s1c1
Sequence:CCGGGTACTGCAACGCCTTCATCTTCTCGAGAAGATGAAGGCGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029929.1-2310s1c1
Sequence:CCGGGCTTTGGTCTCAAAGATACATCTCGAGATGTATCTTTGAGACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks