EMAIL THIS PAGE TO A FRIEND

ZMYND19

zinc finger, MYND-type containing 19

Synonyms: MIZIP RP11-48C7.4
UniProtKB ID: Q96E35, Q5T366
Gene ID:
Human(116225) Summary: ZMYND19 is a MYND zinc finger domain-containing protein that binds to the C terminus of melanin-concentrating hormone receptor-1 (MCHR1; MIM 601751) (Bachner et al., 2002 [PubMed 12208518]
Mouse(67187) zinc finger, MYND domain containing 19
Rat(311791) zinc finger, MYND-type containing 19
Zebrafish(325735) zinc finger, MYND domain containing 19
domestic cat(101086858) zinc finger, MYND-type containing 19
dog(100688730) zinc finger, MYND-type containing 19
chicken(395088) zinc finger, MYND-type containing 19
cow(616678) zinc finger, MYND-type containing 19
naked mole-rat(101717989) zinc finger, MYND-type containing 19
domestic guinea pig(100726855) zinc finger, MYND-type containing 19
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138462 Rosetta Predictions human pricing
NM_198770 Rosetta Predictions rat pricing
NM_026021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024104 predicted 587
2 SASI_Hs01_00024105 predicted 582
3 SASI_Hs01_00024106 predicted 611
4 SASI_Hs01_00024107 predicted 713
5 SASI_Hs01_00024108 predicted 579
6 SASI_Hs01_00024109 predicted 618
7 SASI_Hs02_00363642 predicted 696
8 SASI_Hs01_00024110 predicted 647
9 SASI_Hs01_00024111 predicted 609
10 SASI_Hs01_00024112 predicted 657
11 SASI_Hs01_00024113 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048655 predicted 742
2 SASI_Rn01_00048656 predicted 992
3 SASI_Rn01_00048657 predicted 324
4 SASI_Rn01_00048658 predicted 523
5 SASI_Rn01_00048659 predicted 380
6 SASI_Rn01_00048660 predicted 316
7 SASI_Rn01_00048661 predicted 719
8 SASI_Rn01_00048662 predicted 327
9 SASI_Rn01_00048663 predicted 667
10 SASI_Rn01_00048664 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030688 predicted 330
2 SASI_Mm01_00030689 predicted 329
3 SASI_Mm01_00030690 predicted 532
4 SASI_Mm01_00030691 predicted 998
5 SASI_Mm02_00329493 predicted 251
6 SASI_Mm01_00030692 predicted 683
7 SASI_Mm01_00030693 predicted 343
8 SASI_Mm01_00030694 predicted 677
9 SASI_Mm01_00030695 predicted 735
10 SASI_Mm01_00030696 predicted 682
11 SASI_Mm01_00030687 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026021
VALIDATED
ZMYND19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-587s21c1
Sequence:CCGGAGCTTCCCACAGACCCTATAGCTCGAGCTATAGGGTCTGTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-626s21c1
Sequence:CCGGTGAATGTGACCCGGTACTATACTCGAGTATAGTACCGGGTCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-968s21c1
Sequence:CCGGGTGCCAAAGAAGCCAGCAATGCTCGAGCATTGCTGGCTTCTTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.3-627s1c1
Sequence:CCGGGAATGTGACCCGGTACTATAACTCGAGTTATAGTACCGGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-990s21c1
Sequence:CCGGATCCAGAGCAGCTGCCATAAGCTCGAGCTTATGGCAGCTGCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-937s21c1
Sequence:CCGGGCGGAAGACAGACTGTCAGTTCTCGAGAACTGACAGTCTGTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.1-244s1c1
Sequence:CCGGGAAGACCAAATACACACTGATCTCGAGATCAGTGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026021.1-941s1c1
Sequence:CCGGGAAGACAGACTGTCAGTTGAACTCGAGTTCAACTGACAGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026021
VALIDATED
ZMYND19 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-587s21c1
Sequence:CCGGAGCTTCCCACAGACCCTATAGCTCGAGCTATAGGGTCTGTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-626s21c1
Sequence:CCGGTGAATGTGACCCGGTACTATACTCGAGTATAGTACCGGGTCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-968s21c1
Sequence:CCGGGTGCCAAAGAAGCCAGCAATGCTCGAGCATTGCTGGCTTCTTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.3-627s1c1
Sequence:CCGGGAATGTGACCCGGTACTATAACTCGAGTTATAGTACCGGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-990s21c1
Sequence:CCGGATCCAGAGCAGCTGCCATAAGCTCGAGCTTATGGCAGCTGCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-937s21c1
Sequence:CCGGGCGGAAGACAGACTGTCAGTTCTCGAGAACTGACAGTCTGTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.1-244s1c1
Sequence:CCGGGAAGACCAAATACACACTGATCTCGAGATCAGTGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026021.1-941s1c1
Sequence:CCGGGAAGACAGACTGTCAGTTGAACTCGAGTTCAACTGACAGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026021
VALIDATED
ZMYND19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-587s21c1
Sequence:CCGGAGCTTCCCACAGACCCTATAGCTCGAGCTATAGGGTCTGTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-626s21c1
Sequence:CCGGTGAATGTGACCCGGTACTATACTCGAGTATAGTACCGGGTCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026021.3-968s21c1
Sequence:CCGGGTGCCAAAGAAGCCAGCAATGCTCGAGCATTGCTGGCTTCTTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.3-627s1c1
Sequence:CCGGGAATGTGACCCGGTACTATAACTCGAGTTATAGTACCGGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-990s21c1
Sequence:CCGGATCCAGAGCAGCTGCCATAAGCTCGAGCTTATGGCAGCTGCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026021.3-937s21c1
Sequence:CCGGGCGGAAGACAGACTGTCAGTTCTCGAGAACTGACAGTCTGTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026021.1-244s1c1
Sequence:CCGGGAAGACCAAATACACACTGATCTCGAGATCAGTGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026021.1-941s1c1
Sequence:CCGGGAAGACAGACTGTCAGTTGAACTCGAGTTCAACTGACAGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138462
VALIDATED
ZMYND19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 19
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-1115s21c1
Sequence:CCGGCAGGACGGTTCTCATTATTTACTCGAGTAAATAATGAGAACCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-614s21c1
Sequence:CCGGAGCTGCCTACAGACCCTATAGCTCGAGCTATAGGGTCTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-358s21c1
Sequence:CCGGGGAAATGGTGCTAAGATATTTCTCGAGAAATATCTTAGCACCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138462.2-652s21c1
Sequence:CCGGCTAAATGTGACCCGGTATTATCTCGAGATAATACCGGGTCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1078s1c1
Sequence:CCGGGTTCATCTCCAGCAGAGACAACTCGAGTTGTCTCTGCTGGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-386s1c1
Sequence:CCGGCCTTTGACAAGAACCGAGGAACTCGAGTTCCTCGGTTCTTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-703s1c1
Sequence:CCGGGAGAACTCTTGCACCTACTATCTCGAGATAGTAGGTGCAAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-583s1c1
Sequence:CCGGGAGCAAAGCTTGTATTGGCTTCTCGAGAAGCCAATACAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1184s1c1
Sequence:CCGGGCAATGGGAAGGGTAGAAATTCTCGAGAATTTCTACCCTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138462.2-270s1c1
Sequence:CCGGGAAGACCAAATACACGCTGATCTCGAGATCAGCGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-1114s1c1
Sequence:CCGGCCAGGACGGTTCTCATTATTTCTCGAGAAATAATGAGAACCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-355s1c1
Sequence:CCGGGATGGAAATGGTGCTAAGATACTCGAGTATCTTAGCACCATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-637s1c1
Sequence:CCGGGAACAGTTTCCTGTCCTAAATCTCGAGATTTAGGACAGGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138462.2-1221s1c1
Sequence:CCGGGCTGTAATCCTTAAATGGCAACTCGAGTTGCCATTTAAGGATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-634s1c1
Sequence:CCGGGAAGAACAGTTTCCTGTCCTACTCGAGTAGGACAGGAAACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138462.2-651s1c1
Sequence:CCGGCCTAAATGTGACCCGGTATTACTCGAGTAATACCGGGTCACATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138462
VALIDATED
ZMYND19 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 19
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-1115s21c1
Sequence:CCGGCAGGACGGTTCTCATTATTTACTCGAGTAAATAATGAGAACCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-614s21c1
Sequence:CCGGAGCTGCCTACAGACCCTATAGCTCGAGCTATAGGGTCTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-358s21c1
Sequence:CCGGGGAAATGGTGCTAAGATATTTCTCGAGAAATATCTTAGCACCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138462.2-652s21c1
Sequence:CCGGCTAAATGTGACCCGGTATTATCTCGAGATAATACCGGGTCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1078s1c1
Sequence:CCGGGTTCATCTCCAGCAGAGACAACTCGAGTTGTCTCTGCTGGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-386s1c1
Sequence:CCGGCCTTTGACAAGAACCGAGGAACTCGAGTTCCTCGGTTCTTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-703s1c1
Sequence:CCGGGAGAACTCTTGCACCTACTATCTCGAGATAGTAGGTGCAAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-583s1c1
Sequence:CCGGGAGCAAAGCTTGTATTGGCTTCTCGAGAAGCCAATACAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1184s1c1
Sequence:CCGGGCAATGGGAAGGGTAGAAATTCTCGAGAATTTCTACCCTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138462.2-270s1c1
Sequence:CCGGGAAGACCAAATACACGCTGATCTCGAGATCAGCGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-1114s1c1
Sequence:CCGGCCAGGACGGTTCTCATTATTTCTCGAGAAATAATGAGAACCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-355s1c1
Sequence:CCGGGATGGAAATGGTGCTAAGATACTCGAGTATCTTAGCACCATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-637s1c1
Sequence:CCGGGAACAGTTTCCTGTCCTAAATCTCGAGATTTAGGACAGGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138462.2-1221s1c1
Sequence:CCGGGCTGTAATCCTTAAATGGCAACTCGAGTTGCCATTTAAGGATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-634s1c1
Sequence:CCGGGAAGAACAGTTTCCTGTCCTACTCGAGTAGGACAGGAAACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138462.2-651s1c1
Sequence:CCGGCCTAAATGTGACCCGGTATTACTCGAGTAATACCGGGTCACATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138462
VALIDATED
ZMYND19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 19
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-1115s21c1
Sequence:CCGGCAGGACGGTTCTCATTATTTACTCGAGTAAATAATGAGAACCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-614s21c1
Sequence:CCGGAGCTGCCTACAGACCCTATAGCTCGAGCTATAGGGTCTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138462.2-358s21c1
Sequence:CCGGGGAAATGGTGCTAAGATATTTCTCGAGAAATATCTTAGCACCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138462.2-652s21c1
Sequence:CCGGCTAAATGTGACCCGGTATTATCTCGAGATAATACCGGGTCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1078s1c1
Sequence:CCGGGTTCATCTCCAGCAGAGACAACTCGAGTTGTCTCTGCTGGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-386s1c1
Sequence:CCGGCCTTTGACAAGAACCGAGGAACTCGAGTTCCTCGGTTCTTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-703s1c1
Sequence:CCGGGAGAACTCTTGCACCTACTATCTCGAGATAGTAGGTGCAAGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-583s1c1
Sequence:CCGGGAGCAAAGCTTGTATTGGCTTCTCGAGAAGCCAATACAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-1184s1c1
Sequence:CCGGGCAATGGGAAGGGTAGAAATTCTCGAGAATTTCTACCCTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138462.2-270s1c1
Sequence:CCGGGAAGACCAAATACACGCTGATCTCGAGATCAGCGTGTATTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_138462.2-1114s1c1
Sequence:CCGGCCAGGACGGTTCTCATTATTTCTCGAGAAATAATGAGAACCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138462.2-355s1c1
Sequence:CCGGGATGGAAATGGTGCTAAGATACTCGAGTATCTTAGCACCATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-637s1c1
Sequence:CCGGGAACAGTTTCCTGTCCTAAATCTCGAGATTTAGGACAGGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138462.2-1221s1c1
Sequence:CCGGGCTGTAATCCTTAAATGGCAACTCGAGTTGCCATTTAAGGATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138462.2-634s1c1
Sequence:CCGGGAAGAACAGTTTCCTGTCCTACTCGAGTAGGACAGGAAACTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138462.2-651s1c1
Sequence:CCGGCCTAAATGTGACCCGGTATTACTCGAGTAATACCGGGTCACATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks