EMAIL THIS PAGE TO A FRIEND

ZMYND8

zinc finger, MYND-type containing 8

Synonyms: PRKCBP1 PRO2893 RACK7
Gene ID:
Human(23613) Summary: The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(228880) zinc finger, MYND-type containing 8
Rat(296374) zinc finger, MYND-type containing 8
Zebrafish(564460) zinc finger, MYND-type containing 8
chicken(419207) zinc finger, MYND-type containing 8
domestic cat(101081623) zinc finger, MYND-type containing 8
dog(477252) zinc finger, MYND-type containing 8
domestic guinea pig(100723632) zinc finger, MYND-type containing 8
naked mole-rat(101710500) zinc finger, MYND-type containing 8
Domestic Rabbit(100356236) zinc finger, MYND-type containing 8
cow(506031) zinc finger, MYND-type containing 8
sheep(101115146) zinc finger, MYND-type containing 8
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012408 Rosetta Predictions human pricing
NM_183047 Rosetta Predictions human pricing
NM_183048 Rosetta Predictions human pricing
NM_001100838 Rosetta Predictions rat pricing
NM_027230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344255 predicted 820
2 SASI_Hs02_00344256 predicted 948
3 SASI_Hs01_00170929 predicted 874
4 SASI_Hs01_00170931 predicted 1378
5 SASI_Hs01_00170932 predicted 1204
6 SASI_Hs01_00170933 predicted 695
7 SASI_Hs01_00170934 predicted 844
8 SASI_Hs01_00170935 predicted 2324
9 SASI_Hs01_00170936 predicted 590
10 SASI_Hs01_00170937 predicted 1797
11 SASI_Hs01_00170930 predicted 2317
12 SASI_Hs01_00170938 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371207 predicted 815
2 SASI_Hs02_00371208 predicted 951
3 SASI_Hs01_00176710 predicted 874
4 SASI_Hs01_00176712 predicted 1378
5 SASI_Hs01_00176713 predicted 1206
6 SASI_Hs01_00176714 predicted 697
7 SASI_Hs01_00176715 predicted 847
8 SASI_Hs01_00176716 predicted 2333
9 SASI_Hs01_00176717 predicted 589
10 SASI_Hs01_00176718 predicted 1795
11 SASI_Hs01_00176711 predicted 2314
12 SASI_Hs01_00176719 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371209 predicted 747
2 SASI_Hs02_00371210 predicted 872
3 SASI_Hs01_00054125 predicted 801
4 SASI_Hs01_00054127 predicted 1305
5 SASI_Hs01_00054128 predicted 1131
6 SASI_Hs01_00054129 predicted 615
7 SASI_Hs01_00054130 predicted 777
8 SASI_Hs01_00054131 predicted 2258
9 SASI_Hs01_00054132 predicted 516
10 SASI_Hs01_00054133 predicted 1718
11 SASI_Hs01_00054126 predicted 2248
12 SASI_Hs01_00054134 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210682 predicted 1796
2 SASI_Rn02_00210683 predicted 3742
3 SASI_Rn02_00210684 predicted 250
4 SASI_Rn02_00210685 predicted 2139
5 SASI_Rn02_00210686 predicted 2963
6 SASI_Rn02_00210687 predicted 1573
7 SASI_Rn02_00210688 predicted 2088
8 SASI_Rn02_00210689 predicted 3437
9 SASI_Rn02_00210690 predicted 477
10 SASI_Rn02_00210691 predicted 2972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058770 predicted 716
2 SASI_Mm02_00331793 predicted 310
3 SASI_Mm01_00058771 predicted 3613
4 SASI_Mm01_00058772 predicted 2056
5 SASI_Mm02_00331794 predicted 612
6 SASI_Mm02_00331795 predicted 397
7 SASI_Mm02_00331796 predicted 3047
8 SASI_Mm02_00331797 predicted 608
9 SASI_Mm01_00058776 predicted 3881
10 SASI_Mm02_00331798 predicted 538
11 SASI_Mm01_00058773 predicted 935
12 SASI_Mm01_00058774 predicted 2206
13 SASI_Mm01_00058775 predicted 2200
14 SASI_Mm01_00058777 predicted 3865
15 SASI_Mm01_00058778 predicted 840
16 SASI_Mm01_00058779 predicted 3182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183048
VALIDATED
ZMYND8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-3338s1c1
Sequence:CCGGCCCGGAGTAATAAATCCAGTTCTCGAGAACTGGATTTATTACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-591s1c1
Sequence:CCGGCCCTGACTATGCGGAATACATCTCGAGATGTATTCCGCATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-2258s1c1
Sequence:CCGGCCAAACAGGATGTTGTAGGTACTCGAGTACCTACAACATCCTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-986s1c1
Sequence:CCGGCCTGGGTTCCAATAAATAATTCTCGAGAATTATTTATTGGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-1311s1c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_183048.1-2664s21c1
Sequence:CCGGAGCTGATGTCGCCGCTGATATCTCGAGATATCAGCGGCGACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-3330s21c1
Sequence:CCGGTGACCATTCCCGGAGTAATAACTCGAGTTATTACTCCGGGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1833s21c1
Sequence:CCGGTAGTAGCGATAGTGAGTATATCTCGAGATATACTCACTATCGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1155s21c1
Sequence:CCGGACCCAACAGCCAGTATCAAATCTCGAGATTTGATACTGGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1311s21c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183048.1-3716s21c1
Sequence:CCGGCATTGAATCTAGAGGACTTTCCTCGAGGAAAGTCCTCTAGATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-506s21c1
Sequence:CCGGTATCCTACCTGCTCAAGTTTGCTCGAGCAAACTTGAGCAGGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183048
VALIDATED
ZMYND8 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-3338s1c1
Sequence:CCGGCCCGGAGTAATAAATCCAGTTCTCGAGAACTGGATTTATTACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-591s1c1
Sequence:CCGGCCCTGACTATGCGGAATACATCTCGAGATGTATTCCGCATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-2258s1c1
Sequence:CCGGCCAAACAGGATGTTGTAGGTACTCGAGTACCTACAACATCCTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-986s1c1
Sequence:CCGGCCTGGGTTCCAATAAATAATTCTCGAGAATTATTTATTGGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-1311s1c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_183048.1-2664s21c1
Sequence:CCGGAGCTGATGTCGCCGCTGATATCTCGAGATATCAGCGGCGACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-3330s21c1
Sequence:CCGGTGACCATTCCCGGAGTAATAACTCGAGTTATTACTCCGGGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1833s21c1
Sequence:CCGGTAGTAGCGATAGTGAGTATATCTCGAGATATACTCACTATCGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1155s21c1
Sequence:CCGGACCCAACAGCCAGTATCAAATCTCGAGATTTGATACTGGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1311s21c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183048.1-3716s21c1
Sequence:CCGGCATTGAATCTAGAGGACTTTCCTCGAGGAAAGTCCTCTAGATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-506s21c1
Sequence:CCGGTATCCTACCTGCTCAAGTTTGCTCGAGCAAACTTGAGCAGGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183048
VALIDATED
ZMYND8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-3338s1c1
Sequence:CCGGCCCGGAGTAATAAATCCAGTTCTCGAGAACTGGATTTATTACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-591s1c1
Sequence:CCGGCCCTGACTATGCGGAATACATCTCGAGATGTATTCCGCATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183048.1-2258s1c1
Sequence:CCGGCCAAACAGGATGTTGTAGGTACTCGAGTACCTACAACATCCTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-986s1c1
Sequence:CCGGCCTGGGTTCCAATAAATAATTCTCGAGAATTATTTATTGGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_183048.1-1311s1c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_183048.1-2664s21c1
Sequence:CCGGAGCTGATGTCGCCGCTGATATCTCGAGATATCAGCGGCGACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-3330s21c1
Sequence:CCGGTGACCATTCCCGGAGTAATAACTCGAGTTATTACTCCGGGAATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1833s21c1
Sequence:CCGGTAGTAGCGATAGTGAGTATATCTCGAGATATACTCACTATCGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1155s21c1
Sequence:CCGGACCCAACAGCCAGTATCAAATCTCGAGATTTGATACTGGCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-1311s21c1
Sequence:CCGGCCGGATTTCCTTGTCGGATATCTCGAGATATCCGACAAGGAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183048.1-3716s21c1
Sequence:CCGGCATTGAATCTAGAGGACTTTCCTCGAGGAAAGTCCTCTAGATTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183048.1-506s21c1
Sequence:CCGGTATCCTACCTGCTCAAGTTTGCTCGAGCAAACTTGAGCAGGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027230
VALIDATED
ZMYND8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, MYND-type containing 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027230.2-3873s1c1
Sequence:CCGGCGCCACCTTTAGAATTTCCAACTCGAGTTGGAAATTCTAAAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-240s1c1
Sequence:CCGGCGGCTTACTCAACAGTAGCAACTCGAGTTGCTACTGTTGAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1036s1c1
Sequence:CCGGGCCTGGGTTCCAGTCAATAATCTCGAGATTATTGACTGGAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-2565s1c1
Sequence:CCGGCGTGTGGAACGCATCAAGTAACTCGAGTTACTTGATGCGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1009s1c1
Sequence:CCGGGCCCGTTTCTTTGGACAACATCTCGAGATGTTGTCCAAAGAAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-2613s21c1
Sequence:CCGGGGAACGCATCAAGTAAGTTTCCTCGAGGAAACTTACTTGATGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-799s21c1
Sequence:CCGGCCTGCACAACTGCATTATTTACTCGAGTAAATAATGCAGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-3529s21c1
Sequence:CCGGTAACTCGACCCTGGATCTTTCCTCGAGGAAAGATCCAGGGTCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-831s21c1
Sequence:CCGGATCACAAGTTGACGCAAATAGCTCGAGCTATTTGCGTCAACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4027s21c1
Sequence:CCGGGCCAAACACTTTAGGTGTAAGCTCGAGCTTACACCTAAAGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4098s21c1
Sequence:CCGGTACACTGACCTTAACTTATAACTCGAGTTATAAGTTAAGGTCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027230
VALIDATED
ZMYND8 MISSION shRNA shRNA Plasmid DNA
zinc finger, MYND-type containing 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027230.2-3873s1c1
Sequence:CCGGCGCCACCTTTAGAATTTCCAACTCGAGTTGGAAATTCTAAAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-240s1c1
Sequence:CCGGCGGCTTACTCAACAGTAGCAACTCGAGTTGCTACTGTTGAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1036s1c1
Sequence:CCGGGCCTGGGTTCCAGTCAATAATCTCGAGATTATTGACTGGAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-2565s1c1
Sequence:CCGGCGTGTGGAACGCATCAAGTAACTCGAGTTACTTGATGCGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1009s1c1
Sequence:CCGGGCCCGTTTCTTTGGACAACATCTCGAGATGTTGTCCAAAGAAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-2613s21c1
Sequence:CCGGGGAACGCATCAAGTAAGTTTCCTCGAGGAAACTTACTTGATGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-799s21c1
Sequence:CCGGCCTGCACAACTGCATTATTTACTCGAGTAAATAATGCAGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-3529s21c1
Sequence:CCGGTAACTCGACCCTGGATCTTTCCTCGAGGAAAGATCCAGGGTCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-831s21c1
Sequence:CCGGATCACAAGTTGACGCAAATAGCTCGAGCTATTTGCGTCAACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4027s21c1
Sequence:CCGGGCCAAACACTTTAGGTGTAAGCTCGAGCTTACACCTAAAGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4098s21c1
Sequence:CCGGTACACTGACCTTAACTTATAACTCGAGTTATAAGTTAAGGTCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027230
VALIDATED
ZMYND8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, MYND-type containing 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027230.2-3873s1c1
Sequence:CCGGCGCCACCTTTAGAATTTCCAACTCGAGTTGGAAATTCTAAAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-240s1c1
Sequence:CCGGCGGCTTACTCAACAGTAGCAACTCGAGTTGCTACTGTTGAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1036s1c1
Sequence:CCGGGCCTGGGTTCCAGTCAATAATCTCGAGATTATTGACTGGAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-2565s1c1
Sequence:CCGGCGTGTGGAACGCATCAAGTAACTCGAGTTACTTGATGCGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027230.2-1009s1c1
Sequence:CCGGGCCCGTTTCTTTGGACAACATCTCGAGATGTTGTCCAAAGAAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-2613s21c1
Sequence:CCGGGGAACGCATCAAGTAAGTTTCCTCGAGGAAACTTACTTGATGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-799s21c1
Sequence:CCGGCCTGCACAACTGCATTATTTACTCGAGTAAATAATGCAGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027230.3-3529s21c1
Sequence:CCGGTAACTCGACCCTGGATCTTTCCTCGAGGAAAGATCCAGGGTCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-831s21c1
Sequence:CCGGATCACAAGTTGACGCAAATAGCTCGAGCTATTTGCGTCAACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4027s21c1
Sequence:CCGGGCCAAACACTTTAGGTGTAAGCTCGAGCTTACACCTAAAGTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027230.3-4098s21c1
Sequence:CCGGTACACTGACCTTAACTTATAACTCGAGTTATAAGTTAAGGTCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks