EMAIL THIS PAGE TO A FRIEND

ZNF100

zinc finger protein 100

Species: Human ZNF100(163227)
UniProtKB ID: Q8IYN0, Q7M4M0
Gene ID:
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173531 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131431 MISSION® esiRNA esiRNA human ZNF100 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173531 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056220 predicted 315
2 SASI_Hs01_00056221 predicted 574
3 SASI_Hs01_00056222 predicted 1496
4 SASI_Hs01_00056223 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173531
VALIDATED
ZNF100 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 100
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1666s1c1
Sequence:CCGGCCCTAAGCCTTATTAAACAAACTCGAGTTTGTTTAATAAGGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-563s1c1
Sequence:CCGGGCACAAAGAACATGATAACAACTCGAGTTGTTATCATGTTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_173531.1-1661s1c1
Sequence:CCGGCCAGTCCCTAAGCCTTATTAACTCGAGTTAATAAGGCTTAGGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-372s1c1
Sequence:CCGGCCCTGGAATATAAAGAGACATCTCGAGATGTCTCTTTATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1498s1c1
Sequence:CCGGCCTCACAACTAACTGCACATACTCGAGTATGTGCAGTTAGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-667s21c1
Sequence:CCGGAGTGCACAAAGAACATGATAACTCGAGTTATCATGTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-3078s21c1
Sequence:CCGGGTTAGGCATTCAGAGTAATATCTCGAGATATTACTCTGAATGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-266s21c1
Sequence:CCGGAGTCTTCTGGTGCAGTCTTATCTCGAGATAAGACTGCACCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-4191s21c1
Sequence:CCGGGAGTTTGTGTGTATGAATTTGCTCGAGCAAATTCATACACACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-1769s21c1
Sequence:CCGGCAGTCCCTAAGCCTTATTAAACTCGAGTTTAATAAGGCTTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173531
VALIDATED
ZNF100 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 100
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1666s1c1
Sequence:CCGGCCCTAAGCCTTATTAAACAAACTCGAGTTTGTTTAATAAGGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-563s1c1
Sequence:CCGGGCACAAAGAACATGATAACAACTCGAGTTGTTATCATGTTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_173531.1-1661s1c1
Sequence:CCGGCCAGTCCCTAAGCCTTATTAACTCGAGTTAATAAGGCTTAGGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-372s1c1
Sequence:CCGGCCCTGGAATATAAAGAGACATCTCGAGATGTCTCTTTATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1498s1c1
Sequence:CCGGCCTCACAACTAACTGCACATACTCGAGTATGTGCAGTTAGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-667s21c1
Sequence:CCGGAGTGCACAAAGAACATGATAACTCGAGTTATCATGTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-3078s21c1
Sequence:CCGGGTTAGGCATTCAGAGTAATATCTCGAGATATTACTCTGAATGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-266s21c1
Sequence:CCGGAGTCTTCTGGTGCAGTCTTATCTCGAGATAAGACTGCACCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-4191s21c1
Sequence:CCGGGAGTTTGTGTGTATGAATTTGCTCGAGCAAATTCATACACACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-1769s21c1
Sequence:CCGGCAGTCCCTAAGCCTTATTAAACTCGAGTTTAATAAGGCTTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173531
VALIDATED
ZNF100 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 100
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1666s1c1
Sequence:CCGGCCCTAAGCCTTATTAAACAAACTCGAGTTTGTTTAATAAGGCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-563s1c1
Sequence:CCGGGCACAAAGAACATGATAACAACTCGAGTTGTTATCATGTTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_173531.1-1661s1c1
Sequence:CCGGCCAGTCCCTAAGCCTTATTAACTCGAGTTAATAAGGCTTAGGGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-372s1c1
Sequence:CCGGCCCTGGAATATAAAGAGACATCTCGAGATGTCTCTTTATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173531.1-1498s1c1
Sequence:CCGGCCTCACAACTAACTGCACATACTCGAGTATGTGCAGTTAGTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-667s21c1
Sequence:CCGGAGTGCACAAAGAACATGATAACTCGAGTTATCATGTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-3078s21c1
Sequence:CCGGGTTAGGCATTCAGAGTAATATCTCGAGATATTACTCTGAATGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-266s21c1
Sequence:CCGGAGTCTTCTGGTGCAGTCTTATCTCGAGATAAGACTGCACCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173531.3-4191s21c1
Sequence:CCGGGAGTTTGTGTGTATGAATTTGCTCGAGCAAATTCATACACACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173531.3-1769s21c1
Sequence:CCGGCAGTCCCTAAGCCTTATTAAACTCGAGTTTAATAAGGCTTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks