EMAIL THIS PAGE TO A FRIEND

ZNF101

zinc finger protein 101

Synonyms: HZF12
Species: Human ZNF101(94039)
UniProtKB ID: Q8IZC7
Gene ID:
Human(94039) Summary: Zinc finger proteins (ZNFs), such as ZNF101, bind nucleic acids and perform many key functions, the most important of which is regulating transcription (summary by Bellefroid et al., 1993 [PubMed 8467795]
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033204 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005771 MISSION® esiRNA esiRNA targeting human ZNF101 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033204 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173526 predicted 688
2 SASI_Hs01_00173527 predicted 708
3 SASI_Hs01_00173528 predicted 577
4 SASI_Hs01_00173529 predicted 803
5 SASI_Hs02_00360994 predicted 350
6 SASI_Hs01_00173530 predicted 678
7 SASI_Hs01_00173531 predicted 723
8 SASI_Hs01_00173532 predicted 895
9 SASI_Hs01_00173533 predicted 362
10 SASI_Hs01_00173535 predicted 1144
11 SASI_Hs01_00173534 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033204
ZNF101 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 101
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-1209s21c1
Sequence:CCGGGAATGTACAAGGTGTGGTAAACTCGAGTTTACCACACCTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-438s21c1
Sequence:CCGGGTCTTCCTCCGTCATTCATTCCTCGAGGAATGAATGACGGAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-586s1c1
Sequence:CCGGGCACAGTAACACCAACTCGAACTCGAGTTCGAGTTGGTGTTACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-807s1c1
Sequence:CCGGCCTATCGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-597s1c1
Sequence:CCGGCCAACTCGAAAGAGACCTTATCTCGAGATAAGGTCTCTTTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-365s1c1
Sequence:CCGGGATTCCTGATTGTCACCTGAACTCGAGTTCAGGTGACAATCAGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-1078s1c1
Sequence:CCGGCGTCCCTTCAAGCACATGAAACTCGAGTTTCATGTGCTTGAAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033204
ZNF101 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 101
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-1209s21c1
Sequence:CCGGGAATGTACAAGGTGTGGTAAACTCGAGTTTACCACACCTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-438s21c1
Sequence:CCGGGTCTTCCTCCGTCATTCATTCCTCGAGGAATGAATGACGGAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-586s1c1
Sequence:CCGGGCACAGTAACACCAACTCGAACTCGAGTTCGAGTTGGTGTTACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-807s1c1
Sequence:CCGGCCTATCGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-597s1c1
Sequence:CCGGCCAACTCGAAAGAGACCTTATCTCGAGATAAGGTCTCTTTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-365s1c1
Sequence:CCGGGATTCCTGATTGTCACCTGAACTCGAGTTCAGGTGACAATCAGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-1078s1c1
Sequence:CCGGCGTCCCTTCAAGCACATGAAACTCGAGTTTCATGTGCTTGAAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033204
ZNF101 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 101
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-1209s21c1
Sequence:CCGGGAATGTACAAGGTGTGGTAAACTCGAGTTTACCACACCTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033204.2-438s21c1
Sequence:CCGGGTCTTCCTCCGTCATTCATTCCTCGAGGAATGAATGACGGAGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-586s1c1
Sequence:CCGGGCACAGTAACACCAACTCGAACTCGAGTTCGAGTTGGTGTTACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-807s1c1
Sequence:CCGGCCTATCGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-597s1c1
Sequence:CCGGCCAACTCGAAAGAGACCTTATCTCGAGATAAGGTCTCTTTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-365s1c1
Sequence:CCGGGATTCCTGATTGTCACCTGAACTCGAGTTCAGGTGACAATCAGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033204.2-1078s1c1
Sequence:CCGGCGTCCCTTCAAGCACATGAAACTCGAGTTTCATGTGCTTGAAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks