EMAIL THIS PAGE TO A FRIEND

ZNF106

zinc finger protein 106

Synonyms: SH3BP3 ZFP106 ZNF474
Species: Human ZNF106(64397), domestic guinea pig Znf106(100735958), naked mole-rat Znf106(101718517), cow ZNF106(788468)
Gene ID:
domestic guinea pig(100735958) zinc finger protein 106
naked mole-rat(101718517) zinc finger protein 106
cow(788468) zinc finger protein 106
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022473 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123701 MISSION® esiRNA esiRNA human ZFP106 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022473 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163156 predicted 5722
2 SASI_Hs01_00163157 predicted 4763
3 SASI_Hs01_00163158 predicted 5357
4 SASI_Hs02_00355748 predicted 4419
5 SASI_Hs01_00163161 predicted 1018
6 SASI_Hs01_00163162 predicted 2520
7 SASI_Hs02_00355749 predicted 5216
8 SASI_Hs02_00355750 predicted 5793
9 SASI_Hs01_00163165 predicted 1207
10 SASI_Hs02_00355751 predicted 5096
11 SASI_Hs01_00163159 predicted 4058
12 SASI_Hs01_00163160 predicted 4611
13 SASI_Hs01_00163163 predicted 4623
14 SASI_Hs01_00163164 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022473
VALIDATED
ZNF106 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 106
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-6418s1c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5016s1c1
Sequence:CCGGCGGAAATGTATTGGTGTCTTTCTCGAGAAAGACACCAATACATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-3620s1c1
Sequence:CCGGGCAGCAGATAACTATGGAGATCTCGAGATCTCCATAGTTATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5937s1c1
Sequence:CCGGGCAGGACATATTGAACGACATCTCGAGATGTCGTTCAATATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-2324s1c1
Sequence:CCGGCCCTGGCTTATTGCTAGACTTCTCGAGAAGTCTAGCAATAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5122s21c1
Sequence:CCGGATACCATCCGCTGCTATAATGCTCGAGCATTATAGCAGCGGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-4773s21c1
Sequence:CCGGGAAATTGGCACTCGCTATAAACTCGAGTTTATAGCGAGTGCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-6418s21c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-2366s21c1
Sequence:CCGGACAGGTTGATGACTCTATTAACTCGAGTTAATAGAGTCATCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5805s21c1
Sequence:CCGGTTTGGCGTTGTAGATCATTTACTCGAGTAAATGATCTACAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022473
VALIDATED
ZNF106 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 106
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-6418s1c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5016s1c1
Sequence:CCGGCGGAAATGTATTGGTGTCTTTCTCGAGAAAGACACCAATACATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-3620s1c1
Sequence:CCGGGCAGCAGATAACTATGGAGATCTCGAGATCTCCATAGTTATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5937s1c1
Sequence:CCGGGCAGGACATATTGAACGACATCTCGAGATGTCGTTCAATATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-2324s1c1
Sequence:CCGGCCCTGGCTTATTGCTAGACTTCTCGAGAAGTCTAGCAATAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5122s21c1
Sequence:CCGGATACCATCCGCTGCTATAATGCTCGAGCATTATAGCAGCGGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-4773s21c1
Sequence:CCGGGAAATTGGCACTCGCTATAAACTCGAGTTTATAGCGAGTGCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-6418s21c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-2366s21c1
Sequence:CCGGACAGGTTGATGACTCTATTAACTCGAGTTAATAGAGTCATCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5805s21c1
Sequence:CCGGTTTGGCGTTGTAGATCATTTACTCGAGTAAATGATCTACAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022473
VALIDATED
ZNF106 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 106
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-6418s1c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5016s1c1
Sequence:CCGGCGGAAATGTATTGGTGTCTTTCTCGAGAAAGACACCAATACATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-3620s1c1
Sequence:CCGGGCAGCAGATAACTATGGAGATCTCGAGATCTCCATAGTTATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-5937s1c1
Sequence:CCGGGCAGGACATATTGAACGACATCTCGAGATGTCGTTCAATATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022473.1-2324s1c1
Sequence:CCGGCCCTGGCTTATTGCTAGACTTCTCGAGAAGTCTAGCAATAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5122s21c1
Sequence:CCGGATACCATCCGCTGCTATAATGCTCGAGCATTATAGCAGCGGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-4773s21c1
Sequence:CCGGGAAATTGGCACTCGCTATAAACTCGAGTTTATAGCGAGTGCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-6418s21c1
Sequence:CCGGCCAGACTTTGAGGATCAGTTTCTCGAGAAACTGATCCTCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-2366s21c1
Sequence:CCGGACAGGTTGATGACTCTATTAACTCGAGTTAATAGAGTCATCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_022473.1-5805s21c1
Sequence:CCGGTTTGGCGTTGTAGATCATTTACTCGAGTAAATGATCTACAACGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks