EMAIL THIS PAGE TO A FRIEND

ZNF107

zinc finger protein 107

Synonyms: Y8 ZFD25 ZNF588 smap-7
Species: Human ZNF107(51427)
UniProtKB ID: Q9UII5
Gene ID:
Human(51427) Summary: Zinc finger proteins (ZNFs), which bind nucleic acids, perform many key functions, the most important of which is regulating transcription. See ZNF91 (MIM 603971) for general information on ZNFs.[supplied by OMIM, Mar 2008]
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301176 ANTI-ZN107 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016220 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158691 MISSION® esiRNA esiRNA human ZNF588 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013746 Rosetta Predictions human pricing
NM_016220 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057637 predicted 2290
2 SASI_Hs01_00057638 predicted 2705
3 SASI_Hs01_00057640 predicted 2711
4 SASI_Hs01_00057641 predicted 693
5 SASI_Hs01_00057642 predicted 2750
6 SASI_Hs01_00057643 predicted 2406
7 SASI_Hs01_00057644 predicted 2285
8 SASI_Hs01_00057646 predicted 2929
9 SASI_Hs02_00306491 predicted 2904
10 SASI_Hs02_00306492 predicted 2869
11 SASI_Hs01_00057639 predicted 1372
12 SASI_Hs01_00057645 predicted 2368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214967 predicted 2556
2 SASI_Hs01_00214968 predicted 2982
3 SASI_Hs01_00214970 predicted 2975
4 SASI_Hs01_00214971 predicted 960
5 SASI_Hs01_00214972 predicted 3018
6 SASI_Hs01_00214973 predicted 2675
7 SASI_Hs01_00214974 predicted 2555
8 SASI_Hs01_00214976 predicted 3204
9 SASI_Hs02_00349077 predicted 3178
10 SASI_Hs02_00349078 predicted 3141
11 SASI_Hs01_00214969 predicted 1643
12 SASI_Hs01_00214975 predicted 2639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016220
ZNF107 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 107
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2515s21c1
Sequence:CCGGGAGAACCTCTACAAATTTGAACTCGAGTTCAAATTTGTAGAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3048s21c1
Sequence:CCGGCAGAGCTTTCAACCTATCCTCCTCGAGGAGGATAGGTTGAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2563s21c1
Sequence:CCGGTCAAACATTACTAACCATAAGCTCGAGCTTATGGTTAGTAATGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1071s21c1
Sequence:CCGGGAGAAGACATACAGGAAACAACTCGAGTTGTTTCCTGTATGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3136s21c1
Sequence:CCGGTAATTGATCCTACAAGCTTACCTCGAGGTAAGCTTGTAGGATCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2342s21c1
Sequence:CCGGCTAAAGAGAAACTCAACAAATCTCGAGATTTGTTGAGTTTCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-873s21c1
Sequence:CCGGGACACTGAGAAGATACGGAAACTCGAGTTTCCGTATCTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1305s21c1
Sequence:CCGGACAACTTACTAGGCATAAGATCTCGAGATCTTATGCCTAGTAAGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1508s21c1
Sequence:CCGGAGAACCTCTACAAGTGTAAAGCTCGAGCTTTACACTTGTAGAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1631s21c1
Sequence:CCGGACATATCCTCAAACCTTAATACTCGAGTATTAAGGTTTGAGGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016220.3-3235s21c1
Sequence:CCGGTTTCTGCACACACGAGGTATTCTCGAGAATACCTCGTGTGTGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-2059s1c1
Sequence:CCGGCGATTCTCAAACCTAACTATACTCGAGTATAGTTAGGTTTGAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-500s1c1
Sequence:CCGGCAGGAAACAAACACTTCAAATCTCGAGATTTGAAGTGTTTGTTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016220
ZNF107 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 107
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2515s21c1
Sequence:CCGGGAGAACCTCTACAAATTTGAACTCGAGTTCAAATTTGTAGAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3048s21c1
Sequence:CCGGCAGAGCTTTCAACCTATCCTCCTCGAGGAGGATAGGTTGAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2563s21c1
Sequence:CCGGTCAAACATTACTAACCATAAGCTCGAGCTTATGGTTAGTAATGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1071s21c1
Sequence:CCGGGAGAAGACATACAGGAAACAACTCGAGTTGTTTCCTGTATGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3136s21c1
Sequence:CCGGTAATTGATCCTACAAGCTTACCTCGAGGTAAGCTTGTAGGATCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2342s21c1
Sequence:CCGGCTAAAGAGAAACTCAACAAATCTCGAGATTTGTTGAGTTTCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-873s21c1
Sequence:CCGGGACACTGAGAAGATACGGAAACTCGAGTTTCCGTATCTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1305s21c1
Sequence:CCGGACAACTTACTAGGCATAAGATCTCGAGATCTTATGCCTAGTAAGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1508s21c1
Sequence:CCGGAGAACCTCTACAAGTGTAAAGCTCGAGCTTTACACTTGTAGAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1631s21c1
Sequence:CCGGACATATCCTCAAACCTTAATACTCGAGTATTAAGGTTTGAGGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016220.3-3235s21c1
Sequence:CCGGTTTCTGCACACACGAGGTATTCTCGAGAATACCTCGTGTGTGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-2059s1c1
Sequence:CCGGCGATTCTCAAACCTAACTATACTCGAGTATAGTTAGGTTTGAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-500s1c1
Sequence:CCGGCAGGAAACAAACACTTCAAATCTCGAGATTTGAAGTGTTTGTTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016220
ZNF107 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 107
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2515s21c1
Sequence:CCGGGAGAACCTCTACAAATTTGAACTCGAGTTCAAATTTGTAGAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3048s21c1
Sequence:CCGGCAGAGCTTTCAACCTATCCTCCTCGAGGAGGATAGGTTGAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2563s21c1
Sequence:CCGGTCAAACATTACTAACCATAAGCTCGAGCTTATGGTTAGTAATGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1071s21c1
Sequence:CCGGGAGAAGACATACAGGAAACAACTCGAGTTGTTTCCTGTATGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-3136s21c1
Sequence:CCGGTAATTGATCCTACAAGCTTACCTCGAGGTAAGCTTGTAGGATCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-2342s21c1
Sequence:CCGGCTAAAGAGAAACTCAACAAATCTCGAGATTTGTTGAGTTTCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-873s21c1
Sequence:CCGGGACACTGAGAAGATACGGAAACTCGAGTTTCCGTATCTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1305s21c1
Sequence:CCGGACAACTTACTAGGCATAAGATCTCGAGATCTTATGCCTAGTAAGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1508s21c1
Sequence:CCGGAGAACCTCTACAAGTGTAAAGCTCGAGCTTTACACTTGTAGAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016220.3-1631s21c1
Sequence:CCGGACATATCCTCAAACCTTAATACTCGAGTATTAAGGTTTGAGGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016220.3-3235s21c1
Sequence:CCGGTTTCTGCACACACGAGGTATTCTCGAGAATACCTCGTGTGTGCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-2059s1c1
Sequence:CCGGCGATTCTCAAACCTAACTATACTCGAGTATAGTTAGGTTTGAGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016220.2-500s1c1
Sequence:CCGGCAGGAAACAAACACTTCAAATCTCGAGATTTGAAGTGTTTGTTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks