EMAIL THIS PAGE TO A FRIEND

ZNF10

zinc finger protein 10

Synonyms: KOX1
UniProtKB ID: P21506, B2RBS1, Q8TC91
Gene ID:
Human(7556) Summary: The protein encoded by this gene contains a C2H2 zinc finger, and has been shown to function as a transcriptional repressor. The Kruppel-associated box (KRAB) domain of this protein is found to be responsible for its transcriptional repression activity. RING finger containing protein TIF1 was reported to interact with the KRAB domain, and may serve as a mediator for the repression activity of this protein. [provided by RefSeq, Jul 2008]
domestic cat(101092647) zinc finger protein 10
dog(100856748) zinc finger protein 10
cow(100140756) zinc finger protein 10
sheep(101114140) zinc finger protein 10
naked mole-rat(101697704) zinc finger protein 10
domestic guinea pig(100727338) zinc finger protein 10
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015394 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027908 predicted 528
2 SASI_Hs01_00027909 predicted 1643
3 SASI_Hs01_00027911 predicted 711
4 SASI_Hs01_00027912 predicted 1428
5 SASI_Hs02_00347751 predicted 1223
6 SASI_Hs01_00027913 predicted 1898
7 SASI_Hs01_00027914 predicted 1011
8 SASI_Hs02_00347752 predicted 1352
9 SASI_Hs01_00027915 predicted 1018
10 SASI_Hs01_00027916 predicted 892
11 SASI_Hs01_00027907 predicted 916
12 SASI_Hs01_00027910 predicted 1983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015394
ZNF10 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1262s21c1
Sequence:CCGGTTCATAGCTCTAGGCTTATTACTCGAGTAATAAGCCTAGAGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-538s21c1
Sequence:CCGGAGGAATGATCTCTGGTATTTGCTCGAGCAAATACCAGAGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1720s21c1
Sequence:CCGGGTTGGAGAAGAGACCTATAAACTCGAGTTTATAGGTCTCTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-343s21c1
Sequence:GTACCGGTTGGGTTATCAGCTTACTAAGCTCGAGCTTAGTAAGCTGATAACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015394.4-3194s21c1
Sequence:CCGGTAGTTACTGGCTGTGATTATTCTCGAGAATAATCACAGCCAGTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015394.4-3889s1c1
Sequence:CCGGGCCCACATACAACATACCTATCTCGAGATAGGTATGTTGTATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-535s1c1
Sequence:CCGGGCAAGGAATGATCTCTGGTATCTCGAGATACCAGAGATCATTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1683s1c1
Sequence:CCGGCCGGAAGAATGACCTCATTAACTCGAGTTAATGAGGTCATTCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-341s1c1
Sequence:CCGGCCTTGGGTTATCAGCTTACTACTCGAGTAGTAAGCTGATAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1015s1c1
Sequence:CCGGCGCTCTAATCTTACTAGGCATCTCGAGATGCCTAGTAAGATTAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015394
ZNF10 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1262s21c1
Sequence:CCGGTTCATAGCTCTAGGCTTATTACTCGAGTAATAAGCCTAGAGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-538s21c1
Sequence:CCGGAGGAATGATCTCTGGTATTTGCTCGAGCAAATACCAGAGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1720s21c1
Sequence:CCGGGTTGGAGAAGAGACCTATAAACTCGAGTTTATAGGTCTCTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-343s21c1
Sequence:GTACCGGTTGGGTTATCAGCTTACTAAGCTCGAGCTTAGTAAGCTGATAACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015394.4-3194s21c1
Sequence:CCGGTAGTTACTGGCTGTGATTATTCTCGAGAATAATCACAGCCAGTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015394.4-3889s1c1
Sequence:CCGGGCCCACATACAACATACCTATCTCGAGATAGGTATGTTGTATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-535s1c1
Sequence:CCGGGCAAGGAATGATCTCTGGTATCTCGAGATACCAGAGATCATTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1683s1c1
Sequence:CCGGCCGGAAGAATGACCTCATTAACTCGAGTTAATGAGGTCATTCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-341s1c1
Sequence:CCGGCCTTGGGTTATCAGCTTACTACTCGAGTAGTAAGCTGATAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1015s1c1
Sequence:CCGGCGCTCTAATCTTACTAGGCATCTCGAGATGCCTAGTAAGATTAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015394
ZNF10 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1262s21c1
Sequence:CCGGTTCATAGCTCTAGGCTTATTACTCGAGTAATAAGCCTAGAGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-538s21c1
Sequence:CCGGAGGAATGATCTCTGGTATTTGCTCGAGCAAATACCAGAGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-1720s21c1
Sequence:CCGGGTTGGAGAAGAGACCTATAAACTCGAGTTTATAGGTCTCTTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015394.4-343s21c1
Sequence:GTACCGGTTGGGTTATCAGCTTACTAAGCTCGAGCTTAGTAAGCTGATAACCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015394.4-3194s21c1
Sequence:CCGGTAGTTACTGGCTGTGATTATTCTCGAGAATAATCACAGCCAGTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015394.4-3889s1c1
Sequence:CCGGGCCCACATACAACATACCTATCTCGAGATAGGTATGTTGTATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-535s1c1
Sequence:CCGGGCAAGGAATGATCTCTGGTATCTCGAGATACCAGAGATCATTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1683s1c1
Sequence:CCGGCCGGAAGAATGACCTCATTAACTCGAGTTAATGAGGTCATTCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-341s1c1
Sequence:CCGGCCTTGGGTTATCAGCTTACTACTCGAGTAGTAAGCTGATAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015394.4-1015s1c1
Sequence:CCGGCGCTCTAATCTTACTAGGCATCTCGAGATGCCTAGTAAGATTAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks