EMAIL THIS PAGE TO A FRIEND

ZNF114

zinc finger protein 114

UniProtKB ID: Q8NC26, A8K6B0, Q08AQ6
Gene ID:
domestic cat(101094310) zinc finger protein 114
dog(100684128) zinc finger protein 114
cow(100137841) zinc finger protein 114
sheep(101105435) zinc finger protein 114
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153608 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039931 MISSION® esiRNA esiRNA human ZNF114 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016547 predicted 1109
2 SASI_Hs01_00016548 predicted 825
3 SASI_Hs01_00016549 predicted 1320
4 SASI_Hs01_00016550 predicted 650
5 SASI_Hs01_00016552 predicted 702
6 SASI_Hs01_00016553 predicted 1168
7 SASI_Hs01_00016554 predicted 602
8 SASI_Hs01_00016555 predicted 1081
9 SASI_Hs02_00367338 predicted 1246
10 SASI_Hs02_00367339 predicted 996
11 SASI_Hs01_00016546 predicted 983
12 SASI_Hs01_00016551 predicted 1040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153608
ZNF114 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 114
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-708s1c1
Sequence:CCGGCCTGTCTTAAACGATAGTCAACTCGAGTTGACTATCGTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-399s1c1
Sequence:CCGGCAGCCGGATATTCTTCCTAAACTCGAGTTTAGGAAGAATATCCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-565s1c1
Sequence:CCGGAGAAAGATGAATCTCCTGTTACTCGAGTAACAGGAGATTCATCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-989s1c1
Sequence:CCGGCACCTCCAGAAATAACTCAATCTCGAGATTGAGTTATTTCTGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-845s1c1
Sequence:CCGGGCATCATATACGTGATGAAATCTCGAGATTTCATCACGTATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153608.1-1659s21c1
Sequence:CCGGATTCATCTTGAGTAGACATTTCTCGAGAAATGTCTACTCAAGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153608.1-603s21c1
Sequence:CCGGGAAATGAGGAACCACTCTAAACTCGAGTTTAGAGTGGTTCCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153608
ZNF114 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 114
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-708s1c1
Sequence:CCGGCCTGTCTTAAACGATAGTCAACTCGAGTTGACTATCGTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-399s1c1
Sequence:CCGGCAGCCGGATATTCTTCCTAAACTCGAGTTTAGGAAGAATATCCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-565s1c1
Sequence:CCGGAGAAAGATGAATCTCCTGTTACTCGAGTAACAGGAGATTCATCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-989s1c1
Sequence:CCGGCACCTCCAGAAATAACTCAATCTCGAGATTGAGTTATTTCTGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-845s1c1
Sequence:CCGGGCATCATATACGTGATGAAATCTCGAGATTTCATCACGTATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153608.1-1659s21c1
Sequence:CCGGATTCATCTTGAGTAGACATTTCTCGAGAAATGTCTACTCAAGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153608.1-603s21c1
Sequence:CCGGGAAATGAGGAACCACTCTAAACTCGAGTTTAGAGTGGTTCCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153608
ZNF114 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 114
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-708s1c1
Sequence:CCGGCCTGTCTTAAACGATAGTCAACTCGAGTTGACTATCGTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-399s1c1
Sequence:CCGGCAGCCGGATATTCTTCCTAAACTCGAGTTTAGGAAGAATATCCGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-565s1c1
Sequence:CCGGAGAAAGATGAATCTCCTGTTACTCGAGTAACAGGAGATTCATCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-989s1c1
Sequence:CCGGCACCTCCAGAAATAACTCAATCTCGAGATTGAGTTATTTCTGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153608.1-845s1c1
Sequence:CCGGGCATCATATACGTGATGAAATCTCGAGATTTCATCACGTATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153608.1-1659s21c1
Sequence:CCGGATTCATCTTGAGTAGACATTTCTCGAGAAATGTCTACTCAAGATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153608.1-603s21c1
Sequence:CCGGGAAATGAGGAACCACTCTAAACTCGAGTTTAGAGTGGTTCCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks