EMAIL THIS PAGE TO A FRIEND

ZNF117

zinc finger protein 117

Synonyms: H-plk HPF9
Species: Human ZNF117(51351)
UniProtKB ID: Q03924, Q02313, Q7Z7Q7
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015852 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017451 MISSION® esiRNA esiRNA targeting human ZNF117 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015852 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099321 predicted 1373
2 SASI_Hs01_00099322 predicted 1302
3 SASI_Hs01_00099323 predicted 1951
4 SASI_Hs01_00099324 predicted 2078
5 SASI_Hs01_00099325 predicted 1891
6 SASI_Hs01_00099326 predicted 2078
7 SASI_Hs02_00348440 predicted 2645
8 SASI_Hs01_00099327 predicted 1665
9 SASI_Hs01_00099328 predicted 1306
10 SASI_Hs01_00099329 predicted 1697
11 SASI_Hs01_00099330 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015852
ZNF117 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 117
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-1356s1c1
Sequence:CCGGGCAGAACATAAGAGATTCTTTCTCGAGAAAGAATCTCTTATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2407s1c1
Sequence:CCGGGCCCTTAATACACATAAGATACTCGAGTATCTTATGTGTATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2015s1c1
Sequence:CCGGCCGGAGAGAAACGTTATGAATCTCGAGATTCATAACGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2156s1c1
Sequence:CCGGCCCTTACTACACATAAGAGAACTCGAGTTCTCTTATGTGTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015852
ZNF117 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 117
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-1356s1c1
Sequence:CCGGGCAGAACATAAGAGATTCTTTCTCGAGAAAGAATCTCTTATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2407s1c1
Sequence:CCGGGCCCTTAATACACATAAGATACTCGAGTATCTTATGTGTATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2015s1c1
Sequence:CCGGCCGGAGAGAAACGTTATGAATCTCGAGATTCATAACGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2156s1c1
Sequence:CCGGCCCTTACTACACATAAGAGAACTCGAGTTCTCTTATGTGTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015852
ZNF117 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 117
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-1356s1c1
Sequence:CCGGGCAGAACATAAGAGATTCTTTCTCGAGAAAGAATCTCTTATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2407s1c1
Sequence:CCGGGCCCTTAATACACATAAGATACTCGAGTATCTTATGTGTATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2015s1c1
Sequence:CCGGCCGGAGAGAAACGTTATGAATCTCGAGATTCATAACGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015852.1-2156s1c1
Sequence:CCGGCCCTTACTACACATAAGAGAACTCGAGTTCTCTTATGTGTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks