EMAIL THIS PAGE TO A FRIEND

ZNF121

zinc finger protein 121

Synonyms: D19S204 ZHC32 ZNF20
Species: Human ZNF121(7675)
UniProtKB ID: P58317
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008727 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126531 MISSION® esiRNA esiRNA human ZNF121 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008727 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106667 predicted 536
2 SASI_Hs01_00106668 predicted 560
3 SASI_Hs01_00106669 predicted 562
4 SASI_Hs01_00106670 predicted 1034
5 SASI_Hs01_00106672 predicted 1027
6 SASI_Hs01_00106674 predicted 1106
7 SASI_Hs01_00106675 predicted 1291
8 SASI_Hs02_00305546 predicted 416
9 SASI_Hs02_00305547 predicted 1111
10 SASI_Hs02_00305548 predicted 878
11 SASI_Hs01_00106666 predicted 535
12 SASI_Hs01_00106671 predicted 1210
13 SASI_Hs01_00106673 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008727
ZNF121 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 121
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008727.1-1545s1c1
Sequence:CCGGCGAAGACATGAAAGAACTCATCTCGAGATGAGTTCTTTCATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-306s1c1
Sequence:CCGGGCCTTAATGCACACATGGGAACTCGAGTTCCCATGTGTGCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-470s1c1
Sequence:CCGGAGAACGTGGATAGGAGACAAACTCGAGTTTGTCTCCTATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-417s1c1
Sequence:CCGGCTGTGTTGAATCAGTGCAGAACTCGAGTTCTGCACTGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-518s1c1
Sequence:CCGGGCCTTTGTTGATCAGTCACATCTCGAGATGTGACTGATCAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008727
ZNF121 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 121
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008727.1-1545s1c1
Sequence:CCGGCGAAGACATGAAAGAACTCATCTCGAGATGAGTTCTTTCATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-306s1c1
Sequence:CCGGGCCTTAATGCACACATGGGAACTCGAGTTCCCATGTGTGCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-470s1c1
Sequence:CCGGAGAACGTGGATAGGAGACAAACTCGAGTTTGTCTCCTATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-417s1c1
Sequence:CCGGCTGTGTTGAATCAGTGCAGAACTCGAGTTCTGCACTGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-518s1c1
Sequence:CCGGGCCTTTGTTGATCAGTCACATCTCGAGATGTGACTGATCAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008727
ZNF121 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 121
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008727.1-1545s1c1
Sequence:CCGGCGAAGACATGAAAGAACTCATCTCGAGATGAGTTCTTTCATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-306s1c1
Sequence:CCGGGCCTTAATGCACACATGGGAACTCGAGTTCCCATGTGTGCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-470s1c1
Sequence:CCGGAGAACGTGGATAGGAGACAAACTCGAGTTTGTCTCCTATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-417s1c1
Sequence:CCGGCTGTGTTGAATCAGTGCAGAACTCGAGTTCTGCACTGATTCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008727.1-518s1c1
Sequence:CCGGGCCTTTGTTGATCAGTCACATCTCGAGATGTGACTGATCAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks