EMAIL THIS PAGE TO A FRIEND

ZNF124

zinc finger protein 124

Synonyms: HZF-16 HZF16 ZK7
Species: Human ZNF124(7678)
UniProtKB ID: Q15973, B3KNP3, J3KSE1, Q15974, Q4VAJ7, Q5T2V4
Gene ID:
Human(7678) Summary: This gene encodes a member of the Kruppel-type (C2H2) zinc finger protein family. It has a KRAB-A box at its amino terminus and seven consecutively repeated zinc finger motifs at its carboxy terminus. Expression of this gene is increased after vascular endothelial growth factor (VEGF) stimulation in human leukemia cell lines and its expression inhibits apoptotic cell death induced by irradiation or exposure to etoposide. These attributes suggest that this protein may act as a transcription factor. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described for this gene but their biological validity has not been confirmed. This gene has a pseudogene on chromosome 14. [provided by RefSeq, Aug 2011]
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003431 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148891 MISSION® esiRNA esiRNA human ZNF124 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003431 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072043 predicted 1369
2 SASI_Hs01_00072044 predicted 668
3 SASI_Hs01_00072045 predicted 1415
4 SASI_Hs01_00072046 predicted 600
5 SASI_Hs01_00072047 predicted 342
6 SASI_Hs01_00072048 predicted 1287
7 SASI_Hs01_00072049 predicted 435
8 SASI_Hs01_00072050 predicted 1338
9 SASI_Hs01_00072051 predicted 1269
10 SASI_Hs01_00072052 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003431
ZNF124 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 124
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-937s1c1
Sequence:CCGGTCGTGCTAGTACCCTTTGGAACTCGAGTTCCAAAGGGTACTAGCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-439s1c1
Sequence:CCGGCCGTTCTCTTAATAGACATAACTCGAGTTATGTCTATTAAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-870s1c1
Sequence:CCGGGTGACCATGAAAGGACTCATACTCGAGTATGAGTCCTTTCATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-360s1c1
Sequence:CCGGCATTTCAGATACATCAGAGAACTCGAGTTCTCTGATGTATCTGAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-701s1c1
Sequence:CCGGCAAGGACATATAAAGGCTCATCTCGAGATGAGCCTTTATATGTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1262s21c1
Sequence:CCGGCAGTTGTTCCAGTGGTATTTGCTCGAGCAAATACCACTGGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003431.2-526s21c1
Sequence:CCGGTCACCTTCGTGACCATGAAAGCTCGAGCTTTCATGGTCACGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1079s21c1
Sequence:CCGGAGGTGTAGGAAAGTACTTAATCTCGAGATTAAGTACTTTCCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1340s21c1
Sequence:CCGGTGCCTTCATTTATCCTATAACCTCGAGGTTATAGGATAAATGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003431
ZNF124 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 124
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-937s1c1
Sequence:CCGGTCGTGCTAGTACCCTTTGGAACTCGAGTTCCAAAGGGTACTAGCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-439s1c1
Sequence:CCGGCCGTTCTCTTAATAGACATAACTCGAGTTATGTCTATTAAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-870s1c1
Sequence:CCGGGTGACCATGAAAGGACTCATACTCGAGTATGAGTCCTTTCATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-360s1c1
Sequence:CCGGCATTTCAGATACATCAGAGAACTCGAGTTCTCTGATGTATCTGAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-701s1c1
Sequence:CCGGCAAGGACATATAAAGGCTCATCTCGAGATGAGCCTTTATATGTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1262s21c1
Sequence:CCGGCAGTTGTTCCAGTGGTATTTGCTCGAGCAAATACCACTGGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003431.2-526s21c1
Sequence:CCGGTCACCTTCGTGACCATGAAAGCTCGAGCTTTCATGGTCACGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1079s21c1
Sequence:CCGGAGGTGTAGGAAAGTACTTAATCTCGAGATTAAGTACTTTCCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1340s21c1
Sequence:CCGGTGCCTTCATTTATCCTATAACCTCGAGGTTATAGGATAAATGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003431
ZNF124 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 124
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-937s1c1
Sequence:CCGGTCGTGCTAGTACCCTTTGGAACTCGAGTTCCAAAGGGTACTAGCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-439s1c1
Sequence:CCGGCCGTTCTCTTAATAGACATAACTCGAGTTATGTCTATTAAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-870s1c1
Sequence:CCGGGTGACCATGAAAGGACTCATACTCGAGTATGAGTCCTTTCATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-360s1c1
Sequence:CCGGCATTTCAGATACATCAGAGAACTCGAGTTCTCTGATGTATCTGAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003431.2-701s1c1
Sequence:CCGGCAAGGACATATAAAGGCTCATCTCGAGATGAGCCTTTATATGTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1262s21c1
Sequence:CCGGCAGTTGTTCCAGTGGTATTTGCTCGAGCAAATACCACTGGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003431.2-526s21c1
Sequence:CCGGTCACCTTCGTGACCATGAAAGCTCGAGCTTTCATGGTCACGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1079s21c1
Sequence:CCGGAGGTGTAGGAAAGTACTTAATCTCGAGATTAAGTACTTTCCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003431.2-1340s21c1
Sequence:CCGGTGCCTTCATTTATCCTATAACCTCGAGGTTATAGGATAAATGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks