EMAIL THIS PAGE TO A FRIEND

ZNF12

zinc finger protein 12

Synonyms: GIOT-3 HZF11 KOX3 ZNF325
Gene ID:
Human(7559) Summary: This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
domestic cat(101096276) zinc finger protein 12
Horse(100061429) zinc finger protein 12
dog(100683482) zinc finger protein 12
cow(511194) zinc finger protein 12
sheep(101117132) zinc finger protein 12
naked mole-rat(101701912) zinc finger protein 12
domestic guinea pig(100729814) zinc finger protein 12
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016265 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133391 MISSION® esiRNA esiRNA human ZNF12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006956 Rosetta Predictions human pricing
NM_016265 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342683 predicted 2598
2 SASI_Hs02_00342684 predicted 2456
3 SASI_Hs02_00342685 predicted 1777
4 SASI_Hs02_00342686 predicted 1659
5 SASI_Hs02_00342687 predicted 1571
6 SASI_Hs02_00342688 predicted 1961
7 SASI_Hs02_00342689 predicted 1202
8 SASI_Hs02_00342690 predicted 2475
9 SASI_Hs02_00342691 predicted 1938
10 SASI_Hs02_00342692 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349161 predicted 2719
2 SASI_Hs01_00032690 predicted 2574
3 SASI_Hs02_00349162 predicted 1892
4 SASI_Hs01_00032691 predicted 1774
5 SASI_Hs01_00032694 predicted 1686
6 SASI_Hs01_00032695 predicted 2074
7 SASI_Hs01_00032696 predicted 1318
8 SASI_Hs02_00349163 predicted 2591
9 SASI_Hs01_00032698 predicted 2045
10 SASI_Hs02_00349164 predicted 2154
11 SASI_Hs01_00032689 predicted 1117
12 SASI_Hs01_00032692 predicted 877
13 SASI_Hs01_00032693 predicted 2203
14 SASI_Hs01_00032697 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006956
VALIDATED
ZNF12 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006956.1-4010s1c1
Sequence:CCGGCGTGACACAATGTTAGGCATACTCGAGTATGCCTAACATTGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006956.1-1569s1c1
Sequence:CCGGCCCTTTGTAGACATCGGAGAACTCGAGTTCTCCGATGTCTACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-490s1c1
Sequence:CCGGCCTCCATATTAAGCTTGAGAACTCGAGTTCTCAAGCTTAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-1148s1c1
Sequence:CCGGGCACTTAATGACCATCAGAAACTCGAGTTTCTGATGGTCATTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-491s1c1
Sequence:CCGGCTCCATATTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAATATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-2080s21c2
Sequence:CCGGAGCCCTATGAATGCTATATATCTCGAGATATATAGCATTCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006956.2-4598s21c2
Sequence:CCGGAGTATGAGGTAAGGATCTAATCTCGAGATTAGATCCTTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-956s21c2
Sequence:CCGGGAAATCACTCCTCCATATTAACTCGAGTTAATATGGAGGAGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-802s21c2
Sequence:CCGGGGCAAACTGATGACCTAATAGCTCGAGCTATTAGGTCATCAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006956.2-704s21c2
Sequence:GTACCGGCATTATCAAACCGGATGTTATCTCGAGATAACATCCGGTTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006956
VALIDATED
ZNF12 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006956.1-4010s1c1
Sequence:CCGGCGTGACACAATGTTAGGCATACTCGAGTATGCCTAACATTGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006956.1-1569s1c1
Sequence:CCGGCCCTTTGTAGACATCGGAGAACTCGAGTTCTCCGATGTCTACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-490s1c1
Sequence:CCGGCCTCCATATTAAGCTTGAGAACTCGAGTTCTCAAGCTTAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-1148s1c1
Sequence:CCGGGCACTTAATGACCATCAGAAACTCGAGTTTCTGATGGTCATTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-491s1c1
Sequence:CCGGCTCCATATTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAATATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-2080s21c2
Sequence:CCGGAGCCCTATGAATGCTATATATCTCGAGATATATAGCATTCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006956.2-4598s21c2
Sequence:CCGGAGTATGAGGTAAGGATCTAATCTCGAGATTAGATCCTTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-956s21c2
Sequence:CCGGGAAATCACTCCTCCATATTAACTCGAGTTAATATGGAGGAGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-802s21c2
Sequence:CCGGGGCAAACTGATGACCTAATAGCTCGAGCTATTAGGTCATCAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006956.2-704s21c2
Sequence:GTACCGGCATTATCAAACCGGATGTTATCTCGAGATAACATCCGGTTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006956
VALIDATED
ZNF12 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006956.1-4010s1c1
Sequence:CCGGCGTGACACAATGTTAGGCATACTCGAGTATGCCTAACATTGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006956.1-1569s1c1
Sequence:CCGGCCCTTTGTAGACATCGGAGAACTCGAGTTCTCCGATGTCTACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-490s1c1
Sequence:CCGGCCTCCATATTAAGCTTGAGAACTCGAGTTCTCAAGCTTAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-1148s1c1
Sequence:CCGGGCACTTAATGACCATCAGAAACTCGAGTTTCTGATGGTCATTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006956.1-491s1c1
Sequence:CCGGCTCCATATTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAATATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-2080s21c2
Sequence:CCGGAGCCCTATGAATGCTATATATCTCGAGATATATAGCATTCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006956.2-4598s21c2
Sequence:CCGGAGTATGAGGTAAGGATCTAATCTCGAGATTAGATCCTTACCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-956s21c2
Sequence:CCGGGAAATCACTCCTCCATATTAACTCGAGTTAATATGGAGGAGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006956.2-802s21c2
Sequence:CCGGGGCAAACTGATGACCTAATAGCTCGAGCTATTAGGTCATCAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006956.2-704s21c2
Sequence:GTACCGGCATTATCAAACCGGATGTTATCTCGAGATAACATCCGGTTTGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016265
ZNF12 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-1724s1c1
Sequence:CCGGCTCGCAGAAGTCAGCACTTAACTCGAGTTAAGTGCTGACTTCTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-777s1c1
Sequence:CCGGCTTCAGAGCTATCCAGATGAACTCGAGTTCATCTGGATAGCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-878s1c1
Sequence:CCGGCCTGATTGAAGAGAGAGGTAACTCGAGTTACCTCTCTCTTCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-967s1c1
Sequence:CCGGGCCTCTGTGACTCATGTGAAACTCGAGTTTCACATGAGTCACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016265
ZNF12 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-1724s1c1
Sequence:CCGGCTCGCAGAAGTCAGCACTTAACTCGAGTTAAGTGCTGACTTCTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-777s1c1
Sequence:CCGGCTTCAGAGCTATCCAGATGAACTCGAGTTCATCTGGATAGCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-878s1c1
Sequence:CCGGCCTGATTGAAGAGAGAGGTAACTCGAGTTACCTCTCTCTTCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-967s1c1
Sequence:CCGGGCCTCTGTGACTCATGTGAAACTCGAGTTTCACATGAGTCACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016265
ZNF12 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-1724s1c1
Sequence:CCGGCTCGCAGAAGTCAGCACTTAACTCGAGTTAAGTGCTGACTTCTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-777s1c1
Sequence:CCGGCTTCAGAGCTATCCAGATGAACTCGAGTTCATCTGGATAGCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-878s1c1
Sequence:CCGGCCTGATTGAAGAGAGAGGTAACTCGAGTTACCTCTCTCTTCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016265.1-967s1c1
Sequence:CCGGGCCTCTGTGACTCATGTGAAACTCGAGTTTCACATGAGTCACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks