EMAIL THIS PAGE TO A FRIEND

ZNF131

zinc finger protein 131

Synonyms: ZBTB35 pHZ-10
UniProtKB ID: P52739, B4DRL3, Q6PIF0
Gene ID:
Zebrafish(393477) zinc finger protein 131
Horse(100052919) zinc finger protein 131
domestic cat(101092740) zinc finger protein 131
dog(479345) zinc finger protein 131
chicken(431588) zinc finger protein 131
domestic guinea pig(100732017) zinc finger protein 131
naked mole-rat(101715355) zinc finger protein 131
cow(541143) zinc finger protein 131
sheep(100188915) zinc finger protein 131
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406618 Anti-ZNF131 antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
immunofluorescence, western blot pricing
SAB2108045 Anti-ZNF131 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, rabbit, bovine, zebrafish, rat, canine
western blot pricing
AV47576 Anti-ZNF131 antibody produced in rabbit affinity isolated antibody, lyophilized powder chicken, bovine, human, canine, rabbit, zebrafish, mouse, rat
western blot pricing
SAB2102792 Anti-ZNF131 antibody produced in rabbit affinity isolated antibody bovine, human, rabbit, mouse, canine, rat, horse
western blot pricing
SAB2103829 Anti-ZNF131 antibody produced in rabbit affinity isolated antibody rabbit, canine, bovine, mouse, rat, horse, human, guinea pig
western blot pricing
HPA007023 Anti-ZNF131 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA027748 Anti-ZNF131 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA074630 Anti-ZNF131 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0007690M7 Monoclonal Anti-ZNF131 antibody produced in mouse clone 5F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404547 Monoclonal Anti-ZNF131 antibody produced in mouse clone 5F1, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003432 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048331 MISSION® esiRNA esiRNA human ZNF131 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003432 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031399 predicted 858
2 SASI_Hs01_00031400 predicted 1195
3 SASI_Hs01_00031402 predicted 476
4 SASI_Hs01_00031403 predicted 1398
5 SASI_Hs01_00031404 predicted 1329
6 SASI_Hs01_00031405 predicted 1016
7 SASI_Hs02_00335647 predicted 1585
8 SASI_Hs01_00031407 predicted 1852
9 SASI_Hs02_00335648 predicted 766
10 SASI_Hs01_00031408 predicted 1019
11 SASI_Hs01_00031401 predicted 1895
12 SASI_Hs01_00031406 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003432
VALIDATED
ZNF131 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 131
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-1202s21c1
Sequence:CCGGCCATTGTACTTTATGTGATTTCTCGAGAAATCACATAAAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1017s21c1
Sequence:CCGGCCAAATTGTCATGAACGATTTCTCGAGAAATCGTTCATGACAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-208s21c1
Sequence:CCGGGTAGTAAGTTCTTCTACAAATCTCGAGATTTGTAGAAGAACTTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1939s21c1
Sequence:CCGGTGAACTGTTGTCCGTTGAAACCTCGAGGTTTCAACGGACAACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-676s21c1
Sequence:CCGGTAGCACTGTTGGCAGATATTACTCGAGTAATATCTGCCAACAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003432
VALIDATED
ZNF131 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 131
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-1202s21c1
Sequence:CCGGCCATTGTACTTTATGTGATTTCTCGAGAAATCACATAAAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1017s21c1
Sequence:CCGGCCAAATTGTCATGAACGATTTCTCGAGAAATCGTTCATGACAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-208s21c1
Sequence:CCGGGTAGTAAGTTCTTCTACAAATCTCGAGATTTGTAGAAGAACTTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1939s21c1
Sequence:CCGGTGAACTGTTGTCCGTTGAAACCTCGAGGTTTCAACGGACAACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-676s21c1
Sequence:CCGGTAGCACTGTTGGCAGATATTACTCGAGTAATATCTGCCAACAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003432
VALIDATED
ZNF131 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 131
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-1202s21c1
Sequence:CCGGCCATTGTACTTTATGTGATTTCTCGAGAAATCACATAAAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1017s21c1
Sequence:CCGGCCAAATTGTCATGAACGATTTCTCGAGAAATCGTTCATGACAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-208s21c1
Sequence:CCGGGTAGTAAGTTCTTCTACAAATCTCGAGATTTGTAGAAGAACTTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003432.1-1939s21c1
Sequence:CCGGTGAACTGTTGTCCGTTGAAACCTCGAGGTTTCAACGGACAACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003432.1-676s21c1
Sequence:CCGGTAGCACTGTTGGCAGATATTACTCGAGTAATATCTGCCAACAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks