EMAIL THIS PAGE TO A FRIEND

ZNF132

zinc finger protein 132

Synonyms: pHZ-12
UniProtKB ID: P52740, Q32MI9
Gene ID:
cow(100141141) zinc finger protein 132
sheep(101120188) zinc finger protein 132
naked mole-rat(101710314) zinc finger protein 132
domestic cat(101089479) zinc finger protein 132
Horse(100064637) zinc finger protein 132
dog(484226) zinc finger protein 132
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151741 MISSION® esiRNA esiRNA human ZNF132 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003433 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020202 predicted 2386
2 SASI_Hs01_00020203 predicted 1985
3 SASI_Hs01_00020204 predicted 1293
4 SASI_Hs01_00020205 predicted 945
5 SASI_Hs01_00020206 predicted 924
6 SASI_Hs01_00020207 predicted 1594
7 SASI_Hs01_00020208 predicted 1223
8 SASI_Hs02_00335649 predicted 2144
9 SASI_Hs01_00020209 predicted 897
10 SASI_Hs01_00020210 predicted 2392
11 SASI_Hs01_00020211 predicted 1473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003433
ZNF132 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 132
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2859s21c1
Sequence:CCGGGCCTTGAGGGAAATCTAATTTCTCGAGAAATTAGATTTCCCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2707s21c1
Sequence:CCGGGCAGAAGCCATAGTCACTTTCCTCGAGGAAAGTGACTATGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003433.3-1174s21c1
Sequence:CCGGACTCTGAAGAGATACCATTTACTCGAGTAAATGGTATCTCTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003433.2-2635s1c1
Sequence:CCGGGCCTTCAGAAGCTACTCTGTTCTCGAGAACAGAGTAGCTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-669s1c1
Sequence:CCGGCCCAAGCAGAATGTTTCTGTACTCGAGTACAGAAACATTCTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-2153s1c1
Sequence:CCGGCATTCTCATTAAGCATCAGAACTCGAGTTCTGATGCTTAATGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-1224s1c1
Sequence:CCGGGAGAAATCAATCCTTGGTAATCTCGAGATTACCAAGGATTGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-933s1c1
Sequence:CCGGGCACTTATGAAGAGCTCTAAACTCGAGTTTAGAGCTCTTCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003433
ZNF132 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 132
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2859s21c1
Sequence:CCGGGCCTTGAGGGAAATCTAATTTCTCGAGAAATTAGATTTCCCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2707s21c1
Sequence:CCGGGCAGAAGCCATAGTCACTTTCCTCGAGGAAAGTGACTATGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003433.3-1174s21c1
Sequence:CCGGACTCTGAAGAGATACCATTTACTCGAGTAAATGGTATCTCTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003433.2-2635s1c1
Sequence:CCGGGCCTTCAGAAGCTACTCTGTTCTCGAGAACAGAGTAGCTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-669s1c1
Sequence:CCGGCCCAAGCAGAATGTTTCTGTACTCGAGTACAGAAACATTCTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-2153s1c1
Sequence:CCGGCATTCTCATTAAGCATCAGAACTCGAGTTCTGATGCTTAATGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-1224s1c1
Sequence:CCGGGAGAAATCAATCCTTGGTAATCTCGAGATTACCAAGGATTGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-933s1c1
Sequence:CCGGGCACTTATGAAGAGCTCTAAACTCGAGTTTAGAGCTCTTCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003433
ZNF132 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 132
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2859s21c1
Sequence:CCGGGCCTTGAGGGAAATCTAATTTCTCGAGAAATTAGATTTCCCTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003433.3-2707s21c1
Sequence:CCGGGCAGAAGCCATAGTCACTTTCCTCGAGGAAAGTGACTATGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003433.3-1174s21c1
Sequence:CCGGACTCTGAAGAGATACCATTTACTCGAGTAAATGGTATCTCTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003433.2-2635s1c1
Sequence:CCGGGCCTTCAGAAGCTACTCTGTTCTCGAGAACAGAGTAGCTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-669s1c1
Sequence:CCGGCCCAAGCAGAATGTTTCTGTACTCGAGTACAGAAACATTCTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-2153s1c1
Sequence:CCGGCATTCTCATTAAGCATCAGAACTCGAGTTCTGATGCTTAATGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-1224s1c1
Sequence:CCGGGAGAAATCAATCCTTGGTAATCTCGAGATTACCAAGGATTGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003433.2-933s1c1
Sequence:CCGGGCACTTATGAAGAGCTCTAAACTCGAGTTTAGAGCTCTTCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks