EMAIL THIS PAGE TO A FRIEND

ZNF133

zinc finger protein 133

Synonyms: ZNF150 pHZ-13 pHZ-66
UniProtKB ID: P52736, A8K5S4, Q53XU1, Q5JXV8, Q9BUV2, Q9H443
Gene ID:
dog(477145) zinc finger protein 133
domestic cat(101100461) zinc finger protein 133
Horse(100062220) zinc finger protein 133
naked mole-rat(101715870) zinc finger protein 133
Domestic Rabbit(100346615) zinc finger protein 133
domestic guinea pig(100726226) zinc finger protein 133
cow(616189) zinc finger protein 133
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003434 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055271 MISSION® esiRNA esiRNA human ZNF133 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083330 Rosetta Predictions human pricing
NM_003434 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316910 predicted 969
2 SASI_Hs02_00316911 predicted 1921
3 SASI_Hs02_00316912 predicted 1815
4 SASI_Hs02_00316913 predicted 732
5 SASI_Hs02_00316914 predicted 754
6 SASI_Hs02_00316915 predicted 1232
7 SASI_Hs02_00316916 predicted 984
8 SASI_Hs02_00316917 predicted 944
9 SASI_Hs02_00316918 predicted 1152
10 SASI_Hs02_00316919 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107360 predicted 1383
2 SASI_Hs01_00107362 predicted 2331
3 SASI_Hs01_00107363 predicted 2225
4 SASI_Hs01_00107364 predicted 1144
5 SASI_Hs01_00107365 predicted 1163
6 SASI_Hs01_00107366 predicted 1643
7 SASI_Hs02_00335650 predicted 1395
8 SASI_Hs01_00107367 predicted 1351
9 SASI_Hs01_00107369 predicted 1558
10 SASI_Hs02_00335651 predicted 1893
11 SASI_Hs01_00107361 predicted 1134
12 SASI_Hs01_00107368 predicted 2299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003434
VALIDATED
ZNF133 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 133
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003434.3-2500s1c1
Sequence:CCGGACAAGGACTAAGAGTCAGAATCTCGAGATTCTGACTCTTAGTCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1876s1c1
Sequence:CCGGCCTCAACAGACACCAGAACATCTCGAGATGTTCTGGTGTCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-2301s1c1
Sequence:CCGGCCTTACATCAAATGACACATACTCGAGTATGTGTCATTTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1360s1c1
Sequence:CCGGCCGGAAGTCAACGCTAATCATCTCGAGATGATTAGCGTTGACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-779s1c1
Sequence:CCGGCCGGGTTTCTCCAGTCAGAAACTCGAGTTTCTGACTGGAGAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2491s21c1
Sequence:CCGGGCAACCTTCGGATTCCTTATACTCGAGTATAAGGAATCCGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-1393s21c1
Sequence:CCGGTAACCGGAAGTCAACGCTAATCTCGAGATTAGCGTTGACTTCCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-2221s21c1
Sequence:CCGGTGGACTGGGCTTTGGCAATAACTCGAGTTATTGCCAAAGCCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2330s21c1
Sequence:CCGGCACCTCACCTTACATCAAATGCTCGAGCATTTGATGTAAGGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003434.4-2548s21c1
Sequence:CCGGAGTCAGAATGTTGACACTTTGCTCGAGCAAAGTGTCAACATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003434
VALIDATED
ZNF133 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 133
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003434.3-2500s1c1
Sequence:CCGGACAAGGACTAAGAGTCAGAATCTCGAGATTCTGACTCTTAGTCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1876s1c1
Sequence:CCGGCCTCAACAGACACCAGAACATCTCGAGATGTTCTGGTGTCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-2301s1c1
Sequence:CCGGCCTTACATCAAATGACACATACTCGAGTATGTGTCATTTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1360s1c1
Sequence:CCGGCCGGAAGTCAACGCTAATCATCTCGAGATGATTAGCGTTGACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-779s1c1
Sequence:CCGGCCGGGTTTCTCCAGTCAGAAACTCGAGTTTCTGACTGGAGAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2491s21c1
Sequence:CCGGGCAACCTTCGGATTCCTTATACTCGAGTATAAGGAATCCGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-1393s21c1
Sequence:CCGGTAACCGGAAGTCAACGCTAATCTCGAGATTAGCGTTGACTTCCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-2221s21c1
Sequence:CCGGTGGACTGGGCTTTGGCAATAACTCGAGTTATTGCCAAAGCCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2330s21c1
Sequence:CCGGCACCTCACCTTACATCAAATGCTCGAGCATTTGATGTAAGGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003434.4-2548s21c1
Sequence:CCGGAGTCAGAATGTTGACACTTTGCTCGAGCAAAGTGTCAACATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003434
VALIDATED
ZNF133 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 133
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003434.3-2500s1c1
Sequence:CCGGACAAGGACTAAGAGTCAGAATCTCGAGATTCTGACTCTTAGTCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1876s1c1
Sequence:CCGGCCTCAACAGACACCAGAACATCTCGAGATGTTCTGGTGTCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-2301s1c1
Sequence:CCGGCCTTACATCAAATGACACATACTCGAGTATGTGTCATTTGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-1360s1c1
Sequence:CCGGCCGGAAGTCAACGCTAATCATCTCGAGATGATTAGCGTTGACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003434.3-779s1c1
Sequence:CCGGCCGGGTTTCTCCAGTCAGAAACTCGAGTTTCTGACTGGAGAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2491s21c1
Sequence:CCGGGCAACCTTCGGATTCCTTATACTCGAGTATAAGGAATCCGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-1393s21c1
Sequence:CCGGTAACCGGAAGTCAACGCTAATCTCGAGATTAGCGTTGACTTCCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003434.4-2221s21c1
Sequence:CCGGTGGACTGGGCTTTGGCAATAACTCGAGTTATTGCCAAAGCCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003434.4-2330s21c1
Sequence:CCGGCACCTCACCTTACATCAAATGCTCGAGCATTTGATGTAAGGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003434.4-2548s21c1
Sequence:CCGGAGTCAGAATGTTGACACTTTGCTCGAGCAAAGTGTCAACATTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks