EMAIL THIS PAGE TO A FRIEND

ZNF134

zinc finger protein 134

Synonyms: pHZ-15
UniProtKB ID: P52741, Q9Y4B2
Gene ID:
cow(540014) zinc finger protein 134
domestic guinea pig(100735692) zinc finger protein 134
naked mole-rat(101727595) zinc finger protein 134
Horse(100061185) zinc finger protein 134
domestic cat(101094893) zinc finger protein 134
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003435 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037004 predicted 1101
2 SASI_Hs01_00037005 predicted 1053
3 SASI_Hs01_00037007 predicted 360
4 SASI_Hs02_00335652 predicted 1059
5 SASI_Hs02_00335653 predicted 442
6 SASI_Hs02_00335654 predicted 1104
7 SASI_Hs01_00037010 predicted 1107
8 SASI_Hs02_00335655 predicted 1070
9 SASI_Hs01_00037013 predicted 393
10 SASI_Hs02_00335656 predicted 978
11 SASI_Hs01_00037006 predicted 1243
12 SASI_Hs01_00037008 predicted 1622
13 SASI_Hs01_00037009 predicted 817
14 SASI_Hs01_00037011 predicted 363
15 SASI_Hs01_00037012 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003435
ZNF134 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 134
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-192s21c1
Sequence:CCGGTATAGCAGTGTCACATGTTAACTCGAGTTAACATGTGACACTGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003435.3-1768s21c1
Sequence:CCGGTTACTTTCTTCATGGATATTCCTCGAGGAATATCCATGAAGAAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1065s21c1
Sequence:GTACCGGGAAATCCTTTGGCCACAAATACTCGAGTATTTGTGGCCAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1159s21c1
Sequence:CCGGAGTCGAAGTTCTGACTATATTCTCGAGAATATAGTCAGAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-906s21c1
Sequence:CCGGTAGCCATCACTCCAATCTAATCTCGAGATTAGATTGGAGTGATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-594s1c1
Sequence:CCGGCAACCCTTAAGAAGGGATAAACTCGAGTTTATCCCTTCTTAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003435.1-1860s1c1
Sequence:CCGGCCCTTCTGTATGACAGGTATACTCGAGTATACCTGTCATACAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1289s1c1
Sequence:CCGGGCGAATTCACACTGAGTCAAACTCGAGTTTGACTCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1340s1c1
Sequence:CCGGCTTTAGTCGAAGTTCTGACTACTCGAGTAGTCAGAACTTCGACTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003435
ZNF134 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 134
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-192s21c1
Sequence:CCGGTATAGCAGTGTCACATGTTAACTCGAGTTAACATGTGACACTGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003435.3-1768s21c1
Sequence:CCGGTTACTTTCTTCATGGATATTCCTCGAGGAATATCCATGAAGAAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1065s21c1
Sequence:GTACCGGGAAATCCTTTGGCCACAAATACTCGAGTATTTGTGGCCAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1159s21c1
Sequence:CCGGAGTCGAAGTTCTGACTATATTCTCGAGAATATAGTCAGAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-906s21c1
Sequence:CCGGTAGCCATCACTCCAATCTAATCTCGAGATTAGATTGGAGTGATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-594s1c1
Sequence:CCGGCAACCCTTAAGAAGGGATAAACTCGAGTTTATCCCTTCTTAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003435.1-1860s1c1
Sequence:CCGGCCCTTCTGTATGACAGGTATACTCGAGTATACCTGTCATACAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1289s1c1
Sequence:CCGGGCGAATTCACACTGAGTCAAACTCGAGTTTGACTCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1340s1c1
Sequence:CCGGCTTTAGTCGAAGTTCTGACTACTCGAGTAGTCAGAACTTCGACTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003435
ZNF134 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 134
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-192s21c1
Sequence:CCGGTATAGCAGTGTCACATGTTAACTCGAGTTAACATGTGACACTGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003435.3-1768s21c1
Sequence:CCGGTTACTTTCTTCATGGATATTCCTCGAGGAATATCCATGAAGAAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1065s21c1
Sequence:GTACCGGGAAATCCTTTGGCCACAAATACTCGAGTATTTGTGGCCAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-1159s21c1
Sequence:CCGGAGTCGAAGTTCTGACTATATTCTCGAGAATATAGTCAGAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003435.3-906s21c1
Sequence:CCGGTAGCCATCACTCCAATCTAATCTCGAGATTAGATTGGAGTGATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-594s1c1
Sequence:CCGGCAACCCTTAAGAAGGGATAAACTCGAGTTTATCCCTTCTTAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003435.1-1860s1c1
Sequence:CCGGCCCTTCTGTATGACAGGTATACTCGAGTATACCTGTCATACAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1289s1c1
Sequence:CCGGGCGAATTCACACTGAGTCAAACTCGAGTTTGACTCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003435.1-1340s1c1
Sequence:CCGGCTTTAGTCGAAGTTCTGACTACTCGAGTAGTCAGAACTTCGACTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks