EMAIL THIS PAGE TO A FRIEND

ZNF135

zinc finger protein 135

Synonyms: ZNF61 ZNF78L1 pHZ-17 pT3
Gene ID:
Horse(100062381) zinc finger protein 135
Horse(100063880) zinc finger protein 135
domestic cat(101087435) zinc finger protein 135
cow(508062) zinc finger protein 135
sheep(101111220) zinc finger protein 135
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003436 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114621 MISSION® esiRNA esiRNA human ZNF135 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003436 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170106 predicted 2128
2 SASI_Hs01_00170107 predicted 901
3 SASI_Hs01_00170108 predicted 356
4 SASI_Hs01_00170109 predicted 2105
5 SASI_Hs01_00170110 predicted 857
6 SASI_Hs01_00170111 predicted 2149
7 SASI_Hs01_00170112 predicted 373
8 SASI_Hs01_00170113 predicted 1919
9 SASI_Hs01_00170114 predicted 1791
10 SASI_Hs02_00335657 predicted 2124
11 SASI_Hs01_00170105 predicted 1931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003436
ZNF135 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 135
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003436.2-2337s1c1
Sequence:CCGGCGCCCATTAGTGCTATGTTATCTCGAGATAACATAGCACTAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-372s1c1
Sequence:CCGGCCCAAAGTCAAACTGTCAGTTCTCGAGAACTGACAGTTTGACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-1205s1c1
Sequence:CCGGCTTGACCAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-264s1c1
Sequence:CCGGCATTGGTTACCGAAGCCGAATCTCGAGATTCGGCTTCGGTAACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2536s21c1
Sequence:CCGGAGTCAGAATTTGCCATTATTGCTCGAGCAATAATGGCAAATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-353s21c1
Sequence:CCGGCCCAGAGATTAAGGGACATTTCTCGAGAAATGTCCCTTAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2446s21c1
Sequence:CCGGTGTCCAAGGATTCACCGTATTCTCGAGAATACGGTGAATCCTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-1963s21c1
Sequence:CCGGACGATTGCGGAAAGTCCTTTACTCGAGTAAAGGACTTTCCGCAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003436
ZNF135 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 135
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003436.2-2337s1c1
Sequence:CCGGCGCCCATTAGTGCTATGTTATCTCGAGATAACATAGCACTAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-372s1c1
Sequence:CCGGCCCAAAGTCAAACTGTCAGTTCTCGAGAACTGACAGTTTGACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-1205s1c1
Sequence:CCGGCTTGACCAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-264s1c1
Sequence:CCGGCATTGGTTACCGAAGCCGAATCTCGAGATTCGGCTTCGGTAACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2536s21c1
Sequence:CCGGAGTCAGAATTTGCCATTATTGCTCGAGCAATAATGGCAAATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-353s21c1
Sequence:CCGGCCCAGAGATTAAGGGACATTTCTCGAGAAATGTCCCTTAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2446s21c1
Sequence:CCGGTGTCCAAGGATTCACCGTATTCTCGAGAATACGGTGAATCCTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-1963s21c1
Sequence:CCGGACGATTGCGGAAAGTCCTTTACTCGAGTAAAGGACTTTCCGCAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003436
ZNF135 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 135
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003436.2-2337s1c1
Sequence:CCGGCGCCCATTAGTGCTATGTTATCTCGAGATAACATAGCACTAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-372s1c1
Sequence:CCGGCCCAAAGTCAAACTGTCAGTTCTCGAGAACTGACAGTTTGACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-1205s1c1
Sequence:CCGGCTTGACCAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003436.2-264s1c1
Sequence:CCGGCATTGGTTACCGAAGCCGAATCTCGAGATTCGGCTTCGGTAACCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2536s21c1
Sequence:CCGGAGTCAGAATTTGCCATTATTGCTCGAGCAATAATGGCAAATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-353s21c1
Sequence:CCGGCCCAGAGATTAAGGGACATTTCTCGAGAAATGTCCCTTAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003436.3-2446s21c1
Sequence:CCGGTGTCCAAGGATTCACCGTATTCTCGAGAATACGGTGAATCCTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003436.3-1963s21c1
Sequence:CCGGACGATTGCGGAAAGTCCTTTACTCGAGTAAAGGACTTTCCGCAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks